If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
Address correspondence and reprint requests to: C. Liu, Department of Orthopaedic Surgery & Department of Cell Biology, New York University School of Medicine, 301 East 17th Street, New York, NY 10003, USA. Tel: 1-1212-598-61032; Fax: 1-2123-598-6096.
Cartilage is a highly mechano-responsive tissue. Chondrocytes undergo a series of complex changes, including proliferation and metabolic alteration as the target of external biomechanical and biochemical stimuli. IL-1β is known to regulate chondrocyte metabolism and plays an important role in the pathogenesis of osteoarthritis (OA). The objective of this study was to employ low-intensity pulsed ultrasound (LIPUS) as a localized mechanical stimulus and assess its effects on chondrocyte migration, proliferation, metabolism, and differentiation, as well as its ability to suppress IL-1β mediated catabolism in cartilage.
Methods
Human cartilage explants and chondrocytes were stimulated by LIPUS in the presence and absence of IL-1β to asses cartilage degradation, chondrocytes metabolism, migration, and proliferation. Western blot analyses were conducted to study IL-1β the associated NFκB pathway in chondrocytes.
Results
LIPUS stimulation increased the proteoglycan content in human cartilage explants and inhibited IL-1β induced loss of proteoglycans. LIPUS stimulation increased rates of chondrocyte migration and proliferation, and promoted chondrogenesis in mesenchymal stem cells (MSC). Further, LIPUS suppressed IL-1β induced activation of phosphorylation of NFκB-p65 and IĸBα leading to reduced expression of MMP13 and ADAMT5 in chondrocytes.
Conclusions
Collectively, these data demonstrate the potential therapeutic effects of LIPUS in preventing cartilage degradation and treating OA via a mechanical stimulation that inhibits the catabolic action of IL-1β and stimulates chondrocyte migration, proliferation, and differentiation.
Osteoarthritis (OA) is an articular pathology, characterized by a progressive loss of cartilage, and the development of arthralgia, stiffness, and restricted motion. OA is the most common cause of disability in the American population. According to recent estimates, arthritis treatment costs approximately $128 billion per year to the US economy alone
, an understanding of the precise factors contributing towards OA onset remains elusive. However, several pro-inflammatory cytokines are strongly implicated in initiating and aggravating OA lesions. The most notable cytokine with relation to joint destruction is interleukin-1 beta (IL-1β). IL-1β is highly expressed in OA patients and plays a critical role in the pathogenesis of OA
. The activation of IL-1β is regulated by the IL-1 receptor type 1 (IL-1R) which has been shown to be highly expressed in human OA chondrocytes and synovial fibroblasts, relative to normal cells
. Activation of IL-1β is mediated through several downstream pathways including c-Jun/P38 MAPKs and, more importantly, the nuclear factor κB (NFκB) pathway
Inhibition of interleukin-1-stimulated MAP kinases, activating protein-1 (AP-1) and nuclear factor kappa B (NF-kappa B) transcription factors down-regulates matrix metalloproteinase gene expression in articular chondrocytes.
. IL-1β stimulates the production of nitric oxide synthase (NOS), soluble phospholipase A2, cyclooxygenase 2(Cox-1) and microsomal prostaglandin E synthase 2, contributing to enhanced production of catabolic enzymes such as matrix metalloproteinase 13 (MMP13) and A disintegrin and metalloproteinase with thrombospondin motifs 5 (ADAMTS5) while inhibiting anabolic matrix proteins such as collagens and proteoglycans
Articular cartilage is a highly mechanosensitive tissue and physiological mechanical stimulation of cartilage has been shown to increase the anabolic activity of chondrocytes
. Similarly, increased aggrecan, collagen II (Col II), and proteoglycan expression have been observed following the application of cyclic pressure and hydrostatic pressure in vitro and using explanted chondrocyte cultures
A case-control study to investigate the relation between low and moderate levels of physical activity and osteoarthritis of the knee using data collected as part of the Allied Dunbar National Fitness Survey.
Low-intensity pulsed ultrasound (LIPUS) is an acoustic pressure wave capable of providing localized mechanical stimulus to cells. It has been approved by the FDA as a clinical therapy to promote fracture healing. LIPUS has been reported to enhance chondrocyte proliferation and matrix production through the upregulation of the integrin/P13K/AKT pathway
. Overall LIPUS shows both anabolic and anti-catabolic effects in settings of cartilage degradation.
OA is a multifactorial articular disease that results in increased expression of IL-1β, which in turn activates signaling pathways that cause progressive cartilage degradation. In this study, we examined the chondro-protective effects of LIPUS via its inhibition of IL-1β induced activation of the NFκB pathway.
Methods
Ultrasound setup
LIPUS stimulations were applied using Sonicator® 740× (Mettler Electronics, Anaheim, CA) with 10 cm2 transducer. Cells and explants were cultured in 35 mm plates and were stimulated 20 min per day for the duration of the experiment at 30 mW/cm2, at a frequency of 1 MHz with a pulse duration of 200 μs repeated at 100 Hz, as shown in Fig. 1. The intensity and pulse duration were selected in line with FDA approved parameters for bone healing. The stimulations were conducted in a sterile environment at room temperature. The acoustic gel was used as a coupler between the transducer and cell plate to ensure optimal ultrasound exposure
Enhancement of osteogenic differentiation and proliferation in human mesenchymal stem cells by a modified low intensity ultrasound stimulation under simulated microgravity.
Fig. 1LIPUS stimulation setup. A) Human explant culture with and without IL-1β and LIPUS stimulation at 30 mW/cm2/per day for the duration of experiment. B) Micromass culture with and without IL-1β and LIPUS stimulation at 30 mW/cm2, 20 min per day for the duration of the experiment.
The cartilage explants were harvested from patients receiving total knee joint replacement surgery for OA at New York University Hospital for Joint Diseases (New York, USA). Informed consent was collected from each patient before surgery. The protocol was approved by the Institutional Review Board (IRB#12758). Our studies followed the guidelines of the Institutional Review Board of New York University (NYU) School of Medicine for the use of surgically discarded human tissues. Careful examination of cartilage samples was conducted and only healthy cartilage samples were used in the current study. Cartilage explants were examined for cartilage thickness uniformity (∼2 mm, with superficial, middle, and deep zones intact), surface morphology, and the presence of osteophytes. Articular cartilage was harvested from the tibial plateau of the discarded knees and cut into 3-mm discs using a biopsy punch by Acu-Punch (Acuderm Inc., Ft. Lauderdale, FL). Explanted discs were placed in 6-well plates with Chondrocyte Growth Medium (Cell Applications Inc., San Diego, CA) supplemented with 10% FBS and 1% Penn-Strep.
Micromass cultures
To study the effects of LIPUS on chondrocyte metabolism, C-28/I2 immortalized human chondrocytes (provided by Dr Goldring) were seeded at 2 × 106 cell/cm2 and grown in chondrogenic media supplemented with 10% FBS. Cells were divided into four groups (n = 4): (1) Control, (2) LIPUS, (3) IL-1β (10 ng/ml), and (4) LIPUS + IL-1β.
To study the effects of LIPUS on chondrogenesis, C3H10T1/2 cells (ATCC, VA, USA) were used at 2 × 106 cell/cm2 seeding density. Cell micromasses were cultured in chondrogenic media supplemented with 10% FBS and 100 ng/ml BMP2. Cells were divided into four groups (n = 4) as described above. All in vitro experiments were conducted in biological triplicates.
The explants and cells were maintained at 37C and 5% CO2, the medium was changed every other day.
Safranin O staining
Ex-vivo cartilage explants
Human articular cartilage was collected from five patients ranging from ages 55–75. 3 mm cartilages biopsies were randomly distributed into four groups (n = 3): (1) Control, (2) LIPUS, (3) IL-1β (10 ng/ml), and (4) LIPUS + IL-1β. After 7 days of treatment, explants were fixed in 10% formalin overnight at 4C and embedded in paraffin. Longitudinal sections of 10 microns were made using a microtome. Slides were stained with Safranin O for 30 min with Weigert's Iron Hematoxylin as a counterstain.
Micromass cell cultures
C-28/I2 cells were fixed in 0.1% glutaraldehyde in PBS for 20 min at room temperature and stained with 1% Safranin O Stain for 15 min.
GAG release quantification
Cartilage was collected from eight patients (age 55–75). Five (3 mm) cartilage discs were cultured in each well with 2 ml media per well with four biological replicates (n = 4). Media were collected at Days 1, 3, 5, and 7 and pooled to assay glycosaminoglycan (GAG) degradation over time. GAG release was quantified using Dimethylmethylene Blue Assay (DMMB) as described by Stone et al.
Chondroitin 6-suplhate (Sigma–Aldrich, USA) concentrations were used for standard curves.
Picosirius red staining and quantification
C-28/I2 cells were cultured as micromass and treated with IL-1β and/or LIPUS for 7 days. Cells were fixed with 70% ethanol and stained with 0.1% picosirius red (Electron Microscopes Sciences, PA) for 1 h at room temperature. Excess stain was washed with acidified water. Images were captured at 40× using a Nikon inverted microscope (Nikon Inc, USA). Staining was eluted using extraction buffer (Chondrex Inc., WA) and quantified at 540 nm.
Quantitative real-time PCR
Chondrocytes were cultured in six well plates (3 wells per group) and exposed to IL-1β and LIPUS. After 10 min of stimulation, mRNA was collected from the cells using RNeasy Mini Kit (Qiagen), RNA was pooled and cDNA was synthesized using SuperScript® Reverse Transcriptase (Invitrogen). SYBR® Green PCR Master Mix (Applied Biosystems) was used to perform real-time PCR in StepOnePlus™ Real-Time PCR Systems (Applied Biosystems). PCR reactions were repeated 3 times. qRT-PCR analyses were performed for MMP13 (5′CTTCACGATGGCATTGCTGA3′, 3′AACTCATGCGCAGCAACAAG 5′), ADAMTS4 (5′ AGAAGAAGTTTGACAAGTG 3′, 3′ GCGTGTATTCACCATTGAG 5′), ADAMTS5(5′ ATCACCCAATGCCAAGG 3′, 3′ AGCAGAGTAGGAGACAAC 5′), Col II (5′ TGGTGGAGCAGCAAGAGCAA 3′, 3′ CCGTGGACAGCAGGCGTAGGAA 5′),C OMP (5′ TGCGACGACGACGACGACAA 3′, 3′ CTTGTCTACCACCTTGTCTG5′) to assess chondrocyte metabolism: Sox9 (5′ CGAAATCAACGAGAAACTGGAC 3′, 3′ ATTTAGCACACTGATCACACG 5′) and Col II for chondrogenesis. All data were normalized to 18s (5′ GTAACCCGTTGAACCCCATT 3′, 3′ CCATCCAATCGGTAGTAGCG 5′) as a housekeeping gene for relative gene expression.
Migration scratch assay
C-28/I2 cells were grown to 90% confluency as a monolayer in 35 mm tissue culture plates (n = 3). Scratches were made through the center of each plate using 200ul pipette tips and were observed for cell migration at 24, 48, and 72 h in the presence of IL-1β (10 ng/ml) with and without LIPUS (30 mW/cm2 every 24 h). Migration was captured through images using phase contrast microscopy. The images were analyzed with ImageJ. This enabled us to analyze the scratched area in comparison to the covered area as well as the number of migrated cells.
Proliferation assay
C-28/I2 cells were seeded at 0.2 × 106 cells per 35 mm plate. Cells were treated with IL-1β, with and without LIPUS stimulation and untreated cultures were used as controls (n = 4). Samples were collected at Day 1, 3, and 5 and treated with MTT reagent (Life technologies, USA). Cells were lysed and OD was measured at 570 nm as per manufacturer's instructions.
Western blots
To further study the activation and inhibition of the IL-1β pathway in presences of IL-1β and LIPUS respectively, NFĸB pathway activation was assayed using Western blots. Human cartilage explants from three patients (age 55–75) were randomly distributed into four groups (n = 3 with 3/well). Explants were incubated with IL-1β with and without LIPUS. After 45 min of stimulation, explants were snap frozen in liquid nitrogen and total protein was extracted using RIPA buffer. The protein samples were pooled and concentrations were quantified using a Bradford assay. Lysates were separated by SDS-PAGE and proteins were transferred to nitrocellulose membranes (Bio-Rad. CA). The membranes were incubated overnight at 4C with primary antibodies specific to NFĸB-p65 (Santa Cruz, 1:1000 dilution), pNFĸB-p65 (Cell Signaling Technology, 1:1000 dilution), IĸBα (Santa Cruz, 1:1000 dilution), pIĸBα (Santa Cruz, 1; 1000 dilution), IL-1R1 (Abcam, 1:1000 dilution), and GAPDH (Santa Cruz, 1:1000 dilution) was used a housing keeping protein to assess relative protein expression. Appropriate secondary antibodies were used to visualize the protein signals, which were detected by enhanced chemiluminescence (Bio-Rad, CA). Western blots were run seven times to assess the regulation of NFκB pathway by IL-1β and LIPUS.
Statistical analysis
Statistical analyses were performed using IBM SPSS. Statistically, significant differences between experimental and control groups were determined using Median tests. Western blot data was analyzed using One-Way ANOVA and P values were calculated using Fisher's Least Significant Difference (LSD) post hoc test, P-values less than 0.05 were deemed as significant changes.
Human chondrocytes explants were treated with LIPUS and LIPUS + IL-1β for 7 days. IL-1β treatment caused a marked reduction in the amount of proteoglycans present in the matrix of these explants with little to no visible Safranin O staining relative to control samples [Fig. 2(A)]. In contrast, LIPUS stimulated explants had relatively intense staining, indicating an increase in proteoglycans in the matrix. LIPUS also abrogated the IL-1β induced loss of proteoglycans, with LIPUS treated explants staining similar to control samples [Fig. 2(A)]. GAG release was highest in IL-1β treated samples and LIPUS stimulation in conjunction with IL-1β significantly reduced the GAG release from cartilage explants. LIPUS treated explants exhibited significantly less GAG release relative to non-treated controls [Fig. 2(B)].
Fig. 2LIPUS protects against IL-1β induced GAG depletion. A) IL-1β induced total depletion of GAG content in human cartilage explants (n = 3). LIPUS increased GAG content and rescued IL-1β induced depletion of GAG from cartilage matrix. B) IL-1β treated human explants show increased release of GAG contents into culture media. LIPUS reduced GAG breakdown in cartilage explants and significantly reduced IL-1β induced GAG depletion. C) Chondrocyte micromass cultures show disoriented and patchy GAG content in the presence of IL-1β, LIPUS protects GAG content in the presence of IL-1β and shows an apparent increase in GAG secretion in LIPUS treated samples (* represent statistical difference between Ctrl and IL-1β, P = 0.028, # statistical difference between IL-1β and LIPUS+IL-1β, P = 0.028, † represent statistical difference between Ctrl and LIPUS groups, P = 0.028. Error bars represent 95% confidence interval).
C-28/I2 micromass cultures showed similar trends, with evenly distributed Safranin O staining observed in control cultures. The addition of IL-1β resulted in scattered staining with visible area of minimal or no proteoglycans [Fig. 2(C)]. LIPUS stimulation increased the staining intensity in the cultures without IL-1β and rescued proteoglycan staining in cultures exposed to IL-1β.
Collagen plays an important role in matrix integrity. IL-1β exposure reduced collagen content in C-28/I2 micromass cultures. Picosirius red staining shows a lack of collagen fiber alignment and density relative to control cultures [Fig. 3(A)]. LIPUS stimulation increased collagen fiber density and protected collagen matrix integrity against the detrimental effects of IL-1β [Fig. 3(A)]. Collagen content quantification at 540 nm showed a significant decrease in collagen levels in IL-1β treated cultures. LIPUS retained collagen levels in the presence of IL-1β and enhanced matrix collagen content in LIPUS only treated cultures relative to non-treated controls [Fig. 3(B)].
Fig. 3LIPUS treated micromass cultures retain collagen. A) IL-1β treated cultures show reduced collagen staining with the lack of collagen fiber orientation. LIPUS stimulation intensified collagen staining and retained collagen fiber intensity and integrity in IL-β treated cultures. B) Matrix collagen levels significantly decreased in IL-1β treated micromass cultures. LIPUS stimulation increased matrix collagen content and inhibited IL-1β induced depletion of collagen. * represent statistical difference between Ctrl and IL-1β, P = 0.028, # statistical difference between IL-1β and LIPUS+IL-1β, P = 0.028, † represent statistical difference between Ctrl and LIPUS groups, P = 0.028. Error bars represent 95% confidence intervals.
On the level of gene expression, quantitative real-time PCR demonstrated significant increases in mRNA expression of MMP13 and ADAMTS5 in IL-1β treated chondrocytes [Fig. 4(A)]. Stimulation with LIPUS inhibited IL-1β induced expression of MMP13 and ADAMTS5 to levels comparable to non-treated control samples. LIPUS treated cells also showed reduced mRNA expression of MMP13 and ADAMTS5 relative to non-treated samples. Furthermore, stimulation with LIPUS significantly increased the expression of anabolic marker genes Col II, aggrecan, and cartilage oligomeric matrix protein (COMP) [Fig. 4(B)]. IL-1β exposure significantly reduced the expression of these anabolic markers while LIPUS stimulation inhibited IL-1β induced suppression of Col II, aggrecan, and COMP. LIPUS alone significantly increased Col II, aggrecan and COMP mRNA expression in chondrocytes. Collectively these data illustrate that LIPUS has an anabolic as well as a protective role against IL-1β induced cartilage degradation.
Fig. 4LIPUS regulates chondrocyte metabolism (n = 3). A) LIPUS significantly increase Col II, aggrecan, and COMP expression in chondrocytes and protects against IL-1β induced downregulation of anabolic markers. B) IL-1β significantly increases MMP3 and ADAMTS5 mRNA expression in C-28/I2 cells. LIPUS stimulation significantly reduces IL-1β induced MMP13 and ADAMTS5 mRNA expression. * represent statistical difference between Ctrl and IL-1β, P = 0.028, # statistical difference between IL-1β and LIPUS+IL-1β, P = 0.028, † represent statistical difference between Ctrl and LIPUS groups, P = 0.028. Error bars represent 95% confidence intervals.
. We next sought to examine the effects of LIPUS on the migration and proliferation of C-28/I2 chondrocytes. The scratch migration assay revealed little or no migration of cells in the presence of IL-1β over 72 h [Fig. 5(A)]. LIPUS stimulation increased the rate of migration into the scratched region with or without the presence of IL-1β. ImageJ analysis of images indicated a significant increase in the number of cells and area covered by migrated cells in LIPUS treated cultures. LIPUS stimulation also inhibited IL-1β induced abrogation of chondrocyte migration [Fig. 5(B) and (C)].
Fig. 5LIPUS enhances C-28/I8 cells migration and proliferation (n = 3). A) IL-1β inhibits chondrocyte migration, LIPUS stimulation enhances chondrocyte migration into the empty region and suppresses IL-1β anti-migratory effects. B) The scratch area remains mostly cell-free in IL-1β cultures, LIPUS reverses the IL-1β effects as more than 90% of the area is covered in LIPUS treated cultures. C) The ImageJ analysis shows the significantly higher number of cells (>500 cells) migrated into the scratch area in LIPUS treated cultures in comparison to <50 cells migrated in IL-1β treated culture. D) Proliferation study shows no significant differences at D1 and D3 but LIPUS stimulated cultures to show a significant increase at D5. IL-1β cultures show no or little effect on chondrocyte proliferation. * represent statistical difference between Ctrl and IL-1β, P = 0.028, # statistical difference between IL-1β and LIPUS+IL-1β, P = 0.028, † represent statistical difference between Ctrl and LIPUS groups, P = 0.028. Error bars represent 95% confidence intervals.
Chondrocyte proliferation was assessed using an MTT assay over 5 days of in vitro culture with and without IL-1β and LIPUS stimulation. IL-1β showed no effects on cell proliferation from D1 to D5. However, LIPUS stimulation significantly increased the rate of chondrocyte proliferation by D5 [Fig. 5(D)]. Collectively, the migration and proliferation data show an increase in the rates of migration and proliferation in LIPUS treated cells and an inhibition of IL-1β induced abrogation of chondrocyte migration.
LIPUS attenuates IL-1β suppression of chondrogenesis
Current OA treatments include intra-articular injection of MSC and microfracture, both of which greatly depend on the differentiation of stem cells into chondrocytes. We next determined whether LIPUS affects chondrocyte differentiation. For this purpose, micromass cultures of C3H10T1/2 MSC were cultured in the presence of IL-1β with or without LIPUS stimulation. Quantitative real-time PCR analysis showed LIPUS significantly increased BMP2-induced expression of Col II and Sox 9. In contrast, IL-1β inhibited the expression of Col II and Sox9. LIPUS stimulation antagonized IL-1β inhibition of Col II and Sox 9. Furthermore, LIPUS stimulation alone enhanced Col II and Sox 9 expression in chondrocytes relative to the expression level of control, non-treated chondrocytes (Fig. 6).
Fig. 6LIPUS enhances chondrogenic differentiation of C3H10T1/2. LIPUS significantly increases the expression of Col II and Sox 9 in C3H10T1/2 cells and suppresses IL-1β mediated inhibition of A) Col II and B) Sox9. * represent the statistical difference between Ctrl and IL-1β, P = 0.028, # statistical difference between IL-1β and LIPUS+IL-1β, P = 0.028, † represent the statistical difference between Ctrl and LIPUS groups, P = 0.028. Error bars represent 95% confidence intervals.
. We next examined whether LIPUS was able to inhibit IL-1β mediated activation of NFκB pathway in chondrocytes. Briefly, cartilage explants were treated with IL-1β with or without LIPUS stimulation. Protein expression was normalized to GAPDH and relative phosphorylation was quantified using ImageJ gel analyses. The Western blot analysis showed an increase in phosphorylation of NFκB-p65 and IκBα in IL-1β treated cells. LIPUS treatment suppressed the IL-1β induced phosphorylation of NFκB and Iκβα [Fig. 7(A) and (B)]. LIPUS stimulation alone had little effect on phosphorylation of NFκB-p65 and IκBα.
Fig. 7LIPUS downregulates IL-1β induced activation of NFκB pathway (n = 3): A) Phosphorylation of NFκB-p65 was significantly elevated in cartilage explants after IL- 1β exposure. LIPUS stimulation suppressed IL-1β induced phosphorylation of NFκB-p65. B) LIPUS suppressed IL-1β induced phosphorylation of IκBα in cartilage explants. C) IL-1β exposure increased the expression of IL-1R1. Stimulation with LIPUS significantly reduced the expression of IL-1R1. Expression levels were normalized to GAPDH expression levels. * represent the statistical difference between Ctrl and IL-1β, P < 0.001, # statistical difference between IL-1β and LIPUS+IL-1β. Error bars represent 95% confidence intervals.
Expression of IL-1R was elevated in the presence of IL-1β [Fig. 7(A) and (C)]. LIPUS stimulation significantly reduced IL-1β induced IL-1R expression. Collectively LIPUS antagonized activation of IL-1β induced activation of NFκB pathway and IL-1R expression.
Discussion
OA is a multifactorial degenerative disease that affects hyaline cartilage. It is associated with age, diabetes, obesity, and lifestyle
. The onset of OA remains elusive but numerous studies have shown the critical role of IL-1β in the degradation of cartilage. IL-1β inhibits extracellular matrix protein synthesis and promotes its degradation through the increased expression of MMP-13 and ADAMTS 4/5
Low-intensity pulsed ultrasound inhibits messenger RNA expression of matrix metalloproteinase-13 induced by interleukin-1beta in chondrocytes in an intensity-dependent manner.
. Increased levels of IL-1β have also been associated with decreased expression of both aggrecan and collagen type II. In addition to activation of catabolic enzymes through the NFκB pathways, IL-1β also induces other inflammatory cytokines, such as IL-6 and IL-8
Autocrine production of IL-1 beta by human osteoarthritis-affected cartilage and differential regulation of endogenous nitric oxide, IL-6, prostaglandin E2, and IL-8.
. The culminating synergism of these cytokines produces degenerative effects. Recent studies have shown encouraging results using an IL-1R antagonist (IL-1ra) in OA animal models and clinical trials
Autologous interleukin-1 receptor antagonist improves function and symptoms in osteoarthritis when compared to placebo in a prospective randomized controlled trial.
. IL-1ra may potentially slow OA progression but its effects are limited to suppressing IL-1β induced matrix degradation, with no anabolic effects demonstrated.
Ultrasound is a mechanical stimulus known to activate mechano-transductive pathways associated with annexin V, integrin, stretch activation, and ion channels
. Ultrasound-stimulated C-28/I2 chondrocytes have shown the activation of integrin and stretched activated channels leading to elevated mRNA expression pathways and increased expression of collagen type II and aggrecan
Low-intensity pulsed ultrasound inhibits messenger RNA expression of matrix metalloproteinase-13 induced by interleukin-1beta in chondrocytes in an intensity-dependent manner.
Low-intensity pulsed ultrasound inhibits messenger RNA expression of matrix metalloproteinase-13 induced by interleukin-1beta in chondrocytes in an intensity-dependent manner.
. LIPUS stimulation also significantly reduced IL-1β induced expression of Cox-2 in mandibular condylar chondrocytes through inhibition of IL-1β activated ERK1/2 phosphorylation
. LIPUS at an intensity of 30 mW/cm2 for 20 min/day has been shown to significantly increase osteogenic differentiation, osteoblast proliferation, and bone healing in both in vitro and in vivo models
Enhancement of osteogenic differentiation and proliferation in human mesenchymal stem cells by a modified low intensity ultrasound stimulation under simulated microgravity.
In this study, we explored the potential of employing LIPUS as a potential IL-1β antagonist, pro-anabolic, and chondroprotective therapy. LIPUS stimulation showed a significant increase in the expression of Col II, and aggrecan mRNA in human cartilage explants while IL-1β reduced the expression of Col II and aggrecan concomitant with increased mRNA expression of MMP13 and ADAMTS4. In human cartilage explants treated with IL-β and LIPUS, LIPUS restored Col II and aggrecan expression while suppressing IL-1β induced expression of MMP13 and ADAMTS5. Furthermore, LIPUS stimulation reduced the expression of MMP13 and ADAMTS5 mRNA in C-28/I2 cells, demonstrating potential anti-catabolic effects of LIPUS. Similar trends were observed in Safranin O staining of human cartilage explants after 7 days of exposure to LIPUS with or without IL-1β. GAG release analysis showed a significant increase in the degradation of cartilage matrix in IL-1β treated explants. Application of LIPUS significantly slowed down matrix degradation induced by IL-1β. Further, LIPUS treated samples showed higher retention of GAGs relative to control samples. LIPUS protected against IL-1β induced GAGs depletion of the extracellular cartilage matrix.
Cartilage regeneration is highly dependent on chondrocyte proliferation and migration. The current study has shown that IL-1β significantly reduced chondrocyte migration but had little or no effect on chondrocyte proliferation. The application of LIPUS enhanced chondrocyte migration and rescued the IL-1β treated chondrocytes. LIPUS stimulation also increased chondrocyte proliferation after 5 days of stimulation with little differences in first 3 days of stimulation. Delayed proliferative effects of C-28/I2 cells may be attributed to the slow proliferative tendency of chondrocytes. C-28/I2 cell migration was studied for 72 h. Control and LIPUS stimulated cells fully migrated into the scratch region while little or no migration was observed in IL-1β treated samples. Application of LIPUS restored cell migration, fully inhibiting IL-1β ablation of cellular migration. Cell migration and proliferation are important for cartilage regeneration and repair. Cumulatively, these results indicate that LIPUS may present an avenue for the enhancement of cell migration and proliferation; two processes integral to cartilage repair that are, at least partially, hampered by IL-1β.
In the clinic, arthroscopic microfracture is used as a therapeutic approach in the treatment of OA. However, the success rate of this approach is limited due to the adverse effect of high IL-1β levels on MSC differentiation. Simsa-Maziel et al., have shown that an increased amount of IL-1β significantly reduces the rate chondrocyte differentiation in ATDC5 cells by inhibiting expression of alkaline phosphatase, Runx2, Sox 9, Col II and X, mediated by activation of P38 MAPK and NFκB pathways
. Our current study confirms the published results of Simsa-Maziel et al., as IL-1β treated C3H10T1/2 cells showed a significant reduction in the expression of Col II and Sox 9
. IL-1β was shown to increase cell proliferation in ATDC5 cells, which was not observed in current study with C-28/I2 chondrocytes. This difference is probably attributable to the difference in cell types tested
. LIPUS stimulation increased the level of expression of Col II and Sox 9 in C3H10T1/2 cell and antagonized the detrimental effects of IL-1β.
IL-1β suppresses the level of Col II and aggrecan expression through activation of NFκB pathway. Treating cartilage explants with LIPUS suppressed the IL-1β induced phosphorylation of NFĸB-p65 and Iĸβα. Furthermore, LIPUS inhibited the expression of IL-1R in presence of IL-1β, thereby making chondrocytes less susceptible to the catabolic and inflammatory effects of IL-1β.
The underlying mechanism of ultrasound stimulation on gene regulation remains unclear. Mechanotransductive studies have shown that membrane-bound mechanosensors such as stretch-activated channels, integrins, ion channels, and gap junctions can play important roles in regulating gene expression through several pathways. The most notable pathways are P13K/AKT, MAPK/ERK1/2, P38 and JNK
Low-intensity pulsed ultrasound activates the phosphatidylinositol 3 kinase/Akt pathway and stimulates the growth of chondrocytes in three-dimensional cultures: a basic science study.
Arthritis Res Ther.2008; 10 (doi:ar2451 [pii] 10.1186/ar2451): R77
. A recent study by Whitney et al., shows that the phosphorylation of FAK/Src/CrkII complex and activation MAPK/ERK pathways potentially leading to altered gene expression, cell proliferation, migration, and survival
. The data from our current study show that LIPUS not only can suppress IL-1β induced cartilage degradation through MMP13 and ADAMTS 5 but also can facilitate cartilage regeneration through chondrocyte migration, proliferation, and differentiation. Our assays also demonstrate that LIPUS stimulation largely suppresses the activation of IL-1β induced NFκB activation. LIPUS reduced the expression of NFκB associated IL-1β receptor, IL-1R, and also reduced phosphorylation of downstream IκBα and NFκB-p65.
Recent studies show that LIPUS stimulation can decrease the expression of MMP13 mRNA expression and reduce matrix degradation. The chondro-regenerative effects of LIPUS may result from other mechano-transductive pathways associated with the janusi-activated kinase (JAK), Signal transducer and activator of transcription (STAT) pathway, Rac activation, calcium and nitric oxide signaling through SIC, G-coupled receptors, or growth factor receptors
. Further studies are required to understand the underlying mechanism of LIPUS effects on cartilage metabolism and regeneration. It is also noted that the current study was limited to in vitro and ex vivo assessment of the effects of LIPUS in cartilage and chondrocytes.
In summary, this study indicates that LIPUS suppresses IL-1β mediated cartilage degeneration and increases levels of extracellular matrix proteins (Col II and aggrecan), facilitates chondrocyte proliferation, migration, and chondrogenic differentiation. Thus, LIPUS may have the potential to be an anabolic and chondo-protective therapeutic treatment for OA and other cartilage degenerative disorders. Further studies to validate the chondroprotective role of LIPUS and to understand the underlying mechanism with in vivo animal models are warranted.
Authors contribution
SU and CJ designed the experiments. SU conducted all experiments and wrote the manuscript. RB conducted safranin O staining. YD and AH ran western blots.
SU, DK, YQ, and CJ did the data analysis and reviewed the manuscript.
Competing financial interest statement
The authors have no conflict of interest and competing financial interests.
Acknowledgements
We cordially thank Dr Young-Su Yi and Dr Jian-lu Wei for their contribution in protein expression data. This study is supported by NIH 1R56AI100901, 5R01AR061484, 1R01AR062207, and ACR Research and Education Foundation.
References
Bitton R.
The economic burden of osteoarthritis.
Am J Manag Care.2009; 15 (doi:11991 [pii]): S230-S235
Inhibition of interleukin-1-stimulated MAP kinases, activating protein-1 (AP-1) and nuclear factor kappa B (NF-kappa B) transcription factors down-regulates matrix metalloproteinase gene expression in articular chondrocytes.
A case-control study to investigate the relation between low and moderate levels of physical activity and osteoarthritis of the knee using data collected as part of the Allied Dunbar National Fitness Survey.
Enhancement of osteogenic differentiation and proliferation in human mesenchymal stem cells by a modified low intensity ultrasound stimulation under simulated microgravity.
Low-intensity pulsed ultrasound inhibits messenger RNA expression of matrix metalloproteinase-13 induced by interleukin-1beta in chondrocytes in an intensity-dependent manner.
Autocrine production of IL-1 beta by human osteoarthritis-affected cartilage and differential regulation of endogenous nitric oxide, IL-6, prostaglandin E2, and IL-8.
Autologous interleukin-1 receptor antagonist improves function and symptoms in osteoarthritis when compared to placebo in a prospective randomized controlled trial.
Low-intensity pulsed ultrasound activates the phosphatidylinositol 3 kinase/Akt pathway and stimulates the growth of chondrocytes in three-dimensional cultures: a basic science study.
Arthritis Res Ther.2008; 10 (doi:ar2451 [pii] 10.1186/ar2451): R77
30148-0&id=gr1.jpg){kind=link}
30148-0&id=gr2.jpg){kind=link}
30148-0&id=gr3.jpg){kind=link}
30148-0&id=gr4.jpg){kind=link}
30148-0&id=gr5.jpg){kind=link}
30148-0&id=gr6.jpg){kind=link}
30148-0&id=gr7.jpg){kind=link}