If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
a Jie XU and Yu LIU contributed equally in this article.
J. Xu
Footnotes
a Jie XU and Yu LIU contributed equally in this article.
Affiliations
State Key Laboratory Breeding Base of Basic Science of Stomatology (Hubei-MOST) & Key Laboratory of Oral Biomedicine Ministry of Education (KLOBM), School and Hospital of Stomatology, Wuhan University, Wuhan, Hubei Province, China
Address correspondence and reprint requests to: X. Long, Department of Oral and Maxillofacial Surgery, School and Hospital of Stomatology, Wuhan University, 237 Luoyu Road, Wuhan, Hubei Province, 430079, China.
Address correspondence and reprint requests to: J. Ke, Wuhan University, State Key Laboratory Breeding Base of Basic Science of Stomatology (Hubei-MOST) & Key Laboratory of Oral Biomedicine Ministry of Education (KLOBM), School and Hospital of Stomatology, 237 Luoyu Road, Wuhan, Hubei Province, 430079, China.
State Key Laboratory Breeding Base of Basic Science of Stomatology (Hubei-MOST) & Key Laboratory of Oral Biomedicine Ministry of Education (KLOBM), School and Hospital of Stomatology, Wuhan University, Wuhan, Hubei Province, China
This study aimed to screen differential expression of microRNAs (miRNAs), and investigate function of the specifically selected miRNA in synovial fibroblasts from patients suffering osteoarthritis of temporomandibular joint (TMJOA).
Methods
MiRNA microarray was used to select differentially expressed miRNAs between TMJOA and normal synovial fibroblasts. The expression of screened miRNA221-3p was quantified using real-time PCR, and its specific target gene was predicted by bioinformatics. After transfection of miRNA221-3p mimics or inhibitor into synovial fibroblasts, the expression of v-Ets avian erythroblastosis virus E26 oncogene homolog 1 (Ets-1) was detected by immunohistochemistry, real-time PCR and Western blot, respectively. Dual luciferase activity was performed to identify the direct regulation of miRNA221-3p on Ets-1. Interlukin-1β (IL-1β) mimics an inflammatory situation.
Results
In TMJOA synovial fibroblasts, eight miRNAs were up-regulated and six miRNAs were down-regulated. MiRNA221-3p was the most down-expressed. A sequence in the 3′-untranslated (3′-UTR) of Ets-1 complementary to the seed sequence of miRNA221-3p. Elevated expression of Ets-1 associated with attenuation of miRNA221-3p. Over-expression of miRNA221-3p suppressed the activity of a reporter construct containing the 3′-UTR of Ets-1 transcript and inhibited the expression of Ets-1 as well as its downstream molecules, matrix metalloproteinase 1 (MMP1) and MMP9 in TMJOA synovial fibroblasts. IL-1β suppressed the expression of miRNA221-3p in both a dose-dependent and time-dependent manner.
Conclusion
The reduction of miRNA221-3p in synovial fibroblasts, attributed from abundance of IL-1β in inflamed circumstance, induces Ets-1 up-regulation and then, initiates MMP1 and MMP9 secretion, thereby leading to continuously pathological development in TMJOA.
Osteoarthritis of temporomandibular joint (TMJOA) is a chronic progressive disease characterized by cartilage degradation, subcondral bone remodeling and synovitis
Evaluation of arthrocentesis with hyaluronic acid injection plus oral glucosamine hydrochloride for temporomandibular joint osteoarthritis in oral-health-related quality of life.
. The pathogenesis of TMJOA still remains unclear, although joint overuse, such as masticatory muscle overload, malocclusion and jaw asymmetry, has been accepted as one of the main causes for TMJOA
. Current attention has switched to the synovial inflammation, as synovial hyperemia and inflammatory stimulants infiltration are reciprocally integrated, and ultimately result in joint degeneration
Effect of interleukin-1beta and dehydroepiandrosterone on the expression of lumican and fibromodulin in fibroblast-like synovial cells of the human temporomandibular joint.
MicroRNAs (miRNAs) are 20–24 nucleotides noncoding RNAs that repress gene expression through binding to 3′-untranslated regions (3′-UTR) of target mRNA and initiating mRNA cleavage
. Up-regulation of miRNA127-5p induced matrix metalloproteinase13 (MMP13) expression in human chondrocytes and thereby accelerating the development of osteoarthritis (OA)
. Elevated miRNA146a expression in peripheral blood mononuclear cells was correlated with prolonged tumor necrosis factor-α (TNF-α) production in patients with rheumatoid arthritis
. However, the potential role of miRNA in the pathogenesis of TMJOA has not been yet investigated.
Synovial fibroblasts cover the inner face of TMJ capsule and secrete high level of long-chain polymeric hyaluronan into joint cavity, which has both lubricating and immune-modulatory properties
. It is appreciated that in the circumstance of TMJOA, activated synovial fibroblasts secrete chemokines to recruit immunocytes, and produce cytokines to promote angiogenesis as well as extracellular matrix degradation
Concerning that miRNAs and synovial fibroblasts both play important roles in joint disease, it is intriguing to explore the expression of miRNAs in these cells and the mechanism underlying the development of TMJOA. Herein we investigated the differential expression profile of miRNAs in between TMJOA and normal synovial fibroblasts, and demonstrated miRNA221-3p to be the most down-regulated in TMJOA. Furthermore, we explored the function of miRNA221-3p on TMJOA synovial fibroblasts and found that miRNA221 negatively regulates the expression of v-Ets avian erythroblastosis virus E26 oncogene homolog 1 (Ets-1) as well as its downstream molecules, MMP1 and MMP9 in cells. Finally, interlukin-1β (IL-1β), a potent inflammatory stimulus abundant in TMJOA, was observed to repress miRNA221-3p expression of synovial fibroblasts.
Materials and methods
Samples and cell culture
A total of five OA synovial specimens (male: 1, female: 4; age (mean): 18–45 (26.4)) were isolated from patients with TMJOA diagnosed according to the Research Diagnostic Criteria for Temporomandibular Disorders (RDC/TMD), at the time of joint surgery in School and Hospital of Stomatology, Wuhan University
. Four non-inflamed synovial specimens (male: 2, female: 2; age (mean): 20–26 (23.5)), verified based on a pathological diagnosis (referred as normal), were obtained from patients with condylar hyperplasia undergoing high condylectomy. The experimental protocol was approved by the Human Research Ethics Committee, School and Hospital of Stomatology, Wuhan University, and written consent was obtained from all patients included in this study.
The synovial membranes were washed three times with phosphate buffer saline (PBS) containing 100 units/ml penicillin and 100 μg/ml streptomycin (Hyclone, Logan, Ut, USA). Afterwards, the tissue was sliced into 1 mm3 pieces and kept at intervals of 5 mm in 25 ml flasks in DMEM (Hyclone) containing 15% FBS (Gibco, Grand Island, NY, USA) at 37°C in a humidified atmosphere containing 5% CO2. Fresh culture media was replaced every 3 days until synovial fibroblasts were near confluent. The cells were harvested by digested with 0.25% trypsin and diluted 1:2 for further expansion. The third to fourth passage cells were used for research.
Microarray assays
A total of seven specimens (four OA and three controls) were prepared according to the Affymetrix miRNA Microarray System protocol. Total RNA was isolated from TMJOA or normal synovial fibroblasts with the mirVana miRNA Isolation Kit (Ambion, Austin, TX, USA). The miRNA were labeled with the miRNA Labeling System (Invitrogen, Carlsbad, CA, USA). Labeled miRNA were then purified and hybridized to a GeneChip miRNA 4.0 Array (Affymetrix, Santa Clara, CA, USA) containing 5214 probes for human, mouse and rat miRNA as annotated in the miRBase Release 20. The miRNAs exhibiting 2-fold changes or more in signal intensity between OA and normal synovial fibroblasts were believed to be differentially expressed.
RNA extraction and real-time PCR assays
TMJOA synovial fibroblasts were serum starved for 8 h and then stimulated with IL-1β for indicated periods of time with gradient doses (0, 0.1, 1, 10 ng/ml) and total RNA was extracted using Trizol (Ambion). MiRNA and mRNA expression were independently quantified using the All-in-One™ miRNA qRT-PCR Detection kit (GeneCopoeia, Rockville, MD, USA) and SYBR Premix Ex TaqTM (TaKaRa, Otsu, Shiga, Japan) according to manufacturer's protocols, respectively. Primers for miRNAs were purchased from GeneCopoeia; MiRNA221-3p (HmiRQP0338), Homo sapiens snRNA U6 (HmiRQP9001) used as internal reference in each reaction. For messenger RNA (mRNA), Primer sequences were as follows: Ets-1 (forward: GCAGCCAGTCATCTTTCAACAGCC, reverse: TCAGCACGGTCCCGCACATA); β-actin (forward: GTCCACCGCAAATGCTTCTA, reverse: TGCTGTCACCTTCACCGTTC).
Western blot analysis
Total proteins (20 μg) were electrophoresed and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, MA, USA). The membranes were individually incubated with antibodies for Ets-1 (Abcam, Cambridge, MA, USA), MMP1 (Abcam), MMP3 (CST, Danvers, MA, USA), MMP9 (Santa Cruz Biotechnology, Santa Cruz, CA, USA). The blots were developed using a horseradish peroxidase-conjugated secondary antibody, and the immunoreactive proteins were visualized with an chemiluminescence (ECL) system (Advansta, Menlo Park, CA, USA), as described previously
Immunohistochemical staining on OA synovial specimens was performed using rabbit polyclonal antibody to Ets-1. The sections were incubated with 0.4% pepsin (Maixin, Fuzhou, China) for 30 min at 37°C, and then incubated with 3% H2O2 for 20 min. Non-specific binding was blocked with a 5% goat blocking serum. The sections were incubated with anti-Ets-1 antibody at 4°C overnight in a humidified chamber. The sections were then washed with PBS and stained by anti-rabbit streptavidin-peroxidase kit (Maixin) according to manufacturer's protocol. At last, the sections were visualized by reacting with 3,3-diaminobenzidine (DAB) (Maixin). Hematoxylin was used for counterstaining for the light microscopy observation.
Fluorescence in situ hybridization (FISH)
FISH for Ets-1 mRNA was performed on 4 μm-thick formalin-fixed paraffin-embedded tissue section. The sequence of probe for Ets-1 mRNA was: CGAGGTATAGCGGGATTCTGGATAGGCTGGGTTGA. The probe was digoxin labeled. FISH assay was performed using tyramide signal amplification (TSA) in situ hybridization detection kit (Focobio, Guangzhou, China). The slides were deparaffinized, pretreated, and hybridized with denatured probes for 20 h at 38°C. The slides were then washed, stained with 4ʹ,6-diamidino-2-phenylindole (DAPI), mounted with antifade, and examined on a fluorescence microscope (Nikon 80i, Japan).
Transfection of miRNA
Synovial fibroblasts were initially seeded at 105 cells/well in 6 cm dishes. The following day, transfection with miRNA221-3p mimics (50 μM), inhibitor (100 μM), negative control or siRNA (50 μM) (GenePharma, Shanghai, China) was carried out using lipoJet (SignaGen, Rockville, MD, USA) according to manufacturer's protocols. The sequences were as follows: MicoRNA221-3p inhibitor: 5′-GAAACCCAGCAGACAAUGUAGCU-3′; MicoRNA221-3p mimics: 5′-AGCUACAUUGUCUGCUGGGUUUC-3′, 5′-AACCCAGCAGACAAUGUAGCUUU-3′; MicoRNA negative control: 5′-UUCUCCGAACGUGUCACGUTT-3′, 5′-ACGUGACACGUUCGGAGAATT-3′; Ets-1 siRNA: 5′-CGCUAUACCUCGGAUUACUTT-3′, 5′-AGUAAUCCGAGGUAUAGCGTT-3′. The transfection efficiency was evaluated using 5-carboxyfluorescein-connected miRNA negative control at 6–8 h after transfection under a fluorescence microscope. The percentage of transfected cells with fluorescence was about 70–80%.
Luciferase report assay
The p-EZX-MT01 miRNA expression reporter vector system (GeneCopoeia) was used to construct the reporter plasmid containing 500 bp of the 3′-untranslated regions (3′-UTR) of human Ets-1 mRNA encompassing the nucleotide sequence complementary to the miRNA221-3p seed sequence (sequence of mature form: CUUUGGGUCGUCUGUUACAUCGA). The mutant plasmid removed the nucleotide sequence complementary to miRNA221-3p. The 3′-UTR of Ets-1 was connected to the end of firefly luciferase module (hLuc), and renilla luciferase (hRLuc) was used as an internal reference.
293E cells were transfected with 2 μg of reporter plasmid and 50 nM miRNA mimics or negative control using lipoJet according to manufacturer's protocols in a 6-well plate. The transfection efficiency was maintained at a level around 70% by fluorescence observation in control group. The luciferase activity assay was performed 48 h after transfection, using the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA) and GloMax 20/20 LUMINOMETER (promega). Firefly luciferase activity was normalized to Renilla luciferase activity.
Statistical analysis
Statistical independence of samples was fulfilled by collecting experimental data from wholly independent cultures of synovial fibroblasts collected from different donors. For real-time PCR and western blotting assay data, non-parametric Mann–Whitney U test was used for two group comparisons. For luciferase report assay data, one-way analysis of variance (ANOVA) was used for multi-comparisons after confirmation of data fulfilling normal distribution and homogeneity of variances. The results were analyzed using SPSS 17.0 statistical software. A level of significance was set at P < 0.05.
Results
Comparison of miRNA profiles in synovial fibroblasts between TMJOA and normal
The results of miRNA microarray test indicated a total of 14 miRNAs were expressed with significant difference between TMJOA and normal synovial fibroblasts [Fig. 1(A)]. The expression of eight miRNAs was up-regulated and that of six miRNAs was down-regulated. Among them, miRNA221-3p was the most down-expressed, 5-fold lower in TMJOA synovial fibroblasts as compared with normal cells.
Fig. 1MiRNA expression profile was compared and analyzed using microarray and quantitative real-time PCR in between OA and normal synovial fibroblasts. A: Results of microarray indicated eight up-regulated and six down-regulated miRNAs in OA synovial fibroblasts significantly compared to controls [three controls (one male, two females; mean age: 24.7) and four OAs (one male, three females; mean age: 21.8)]. MiRNA221-3p was the most down-regulated, 5-fold lower in OA synovial fibroblasts. B: Expression of miRNA221-3p was confirmed in control and OA synovial fibroblasts [four controls (two males, two females; mean age: 23.5) and four OAs (one male, three females; mean age: 21.8], P = 0.0286; Box plots, 25th and 75th percentiles; horizontal solid lines, medians; horizontal bars, minimum and maximum. Data were analyzed using Mann–Whitney U test. *: P < 0.05.
To validate the microarray results, quantitative real-time PCR was used to detect the differential expression of miRNA221-3p between TMJOA and normal synovial fibroblasts. The expression of miRNA221-3p in normal synovial fibroblasts was around 3-fold higher than that in TMJOA synovial fibroblasts (P = 0.0286), which is consistent with microarray results [Fig. 1(B)].
Prediction of target mRNA of miRNA221-3p
We used TargetScan (http://www.targetscan.org/) and miRBase (http://www.mirbase.org/) to identify the possible target transcript of miRNA221-3p. Both identified sequences conserved in the 3′-UTR of Ets-1 mRNA were complementary to miRNA221-3p seed sequence. Ets-1 was currently reported to exert a crucial role in development of inflamed joints associated with hypoxia and inflammation factor stimulation
The transcription factors hypoxia-inducible factor 1alpha and Ets-1 colocalize in the hypoxic synovium of inflamed joints in adjuvant-induced arthritis.
. Accordingly, it was reasonable for us to conjecture that miRNA221-3p might modulate Ets-1 expression in synovial fibroblasts to affect the process of TMJOA.
Differential expression of Ets-1 in synovial fibroblasts between TMJOA and normal
As shown in Fig. 2(A), (B), Ets-1 expression in TMJOA synovial fibroblast was about 7-fold higher than that in normal synovial fibroblasts on protein level (P = 0.0286). The immunohistochemical staining and FISH revealed the expression of Ets-1 was distributed in both synovial lining layer and sublining layer [Fig. 2(C), (E)]. In addition, the newly formed blood vessels demonstrated strongly positive in Ets-1 expression in the sublining layer [Fig. 2(D), (F)]. Taken together, the elevated expression of Ets-1 in TMJOA illustrated the possible role of Ets-1 in the development of joint inflammation.
Fig. 2Western blot, immunohistochemical staining and FISH were used to detect the expression and distribution of Ets-1 in synovial tissue. A: Western blot. B: Data statistics indicated its expression was about 7-fold higher than that in normal synovial fibroblasts [five OAs (one male, four females; mean age: 26.4), four controls (two males, two females; mean age: 23.5)] (P = 0.0286). C,E: Ets-1 expression was distributed in both synovial lining layer and sublining layer of synovial membrane. D,F: Invaded blood vessels were positive expression for Ets-1. Box plots, 25th and 75th percentiles; horizontal solid lines, medians; horizontal bars, minimum and maximum. Data were analyzed using Mann–Whitney U test. *: P < 0.05.
Identification of Ets-1 as a direct target of miR221-3p in TMJOA synovial fibroblasts
Transfection of miRNA221-3p mimics, inhibitor or negative control in TMJOA synovial fibroblasts was performed. The transfection efficiency was verified by real-time PCR (Data not shown). Significantly, both mRNA and protein induction of Ets-1 in cells occurred after transfected with miRNA221-3p inhibitor as compared with the negative control for about 7-fold and 3-fold, respectively. Furthermore, both mRNA and protein expression of Ets-1 in cells attenuated for about 2-fold after transfected with miRNA221-3p mimics, which compared with negative control [Fig. 3(A), (B)].
Fig. 3To confirm the combination of miR221-3p to Ets-1 mRNA, miRNA221-3p mimics, inhibitor or negative control was transfected into OA synovial fibroblast. Ets-1 3′-UTR/mutant reporter system was also co-transfected with miRNA221-3p mimics or negative control in 293E cells for 48 h. A: mRNA level of Ets-1 expression 24 h after transfection of miRNA221-3p mimics and inhibitor. B: Protein expression of Ets-1 48 h after transfection. Note: Expression levels were uniformly set to a value of one in negative control. The data were shown as mean ± SD of n = 3 patients (three females; mean age: 21). C: Structure of 3′-UTR luciferase reporter system. Predicted result of miRNA221-3p targeting Ets-1 mRNA 3′-UTR and mutant sequence. D: Relative luciferase activity was significantly reduced in 3′-UTR+miRNA221-3p group compared with other groups (P = 0.0002). Values were shown as mean ± SD of n = 5 and analyzed using one-way ANOVA test. *P < 0.05. NC: negative control.
To witness the direct effect of miR221-3p on Ets-1 mRNA, Ets-1 3′-UTR/mutant reporter system [Fig. 3(C)] was constructed and transiently transfected into 293 cell line accompanied with miRNA221-3p mimics or negative control. As shown in Fig. 3(D), the over-expression of miRNA221-3p significantly reduced luciferase activity in 3′-UTR+miRNA221-3p group as compared with other groups (P = 0.0002), illustrating that suppression of Ets-1 was due to miRNA221-3p directly binding to the complementary seed sequence in 3′-UTR of Ets-1.
Negative regulation of miRNA221-3p on MMP1 and MMP9 expression by targeting Ets-1 in TMJOA synovial fibroblasts
After transfection of mimics, expression of MMP1 and MMP9 was reduced in TMJOA synovial fibroblasts for 5-fold (P = 0.0571) and 2-fold (P = 0.0286) as compared to that of negative control, respectively. Deficient-expression of miRNA221-3p up-regulated MMP1 and MMP9 expression in cells for about 2-fold (P = 0.0286) as compared with that of negative control [Fig. 4(A), (B), (D)].
Fig. 4To explore effect of miRNA221-3p on MMPs expression, transfection was divided into following four groups: negative control, miRNA221-3p mimics, miRNA221-3p inhibitor, miRNA221-3p inhibitor+specific Ets-1 siRNA. Protein levels were detected after 72 h. A: Western blot was used to detect protein expression of MMP1, MMP3 and MMP9. B: MMP1 expression. C: MMP3 expression. D: MMP9 expression. Box plots, 25th and 75th percentiles; horizontal solid lines, medians; horizontal bars, minimum and maximum. Data were analyzed using Mann–Whitney U test (n = 4 patients, one male, three females; mean age: 21.8). *: P < 0.05 compared with NC group. NC: negative control.
To understand whether Ets-1 is directly responsible for MMPs regulation in TMJOA synovial fibroblasts, siRNA was used to knock down the expression of Ets-1. Silencing of Ets-1 expression in cells counteracted the effect on the up-regulation of MMP1 and MMP9 after transfection of miRNA221-3p inhibitor alone (P = 0.0286) [Fig. 4(B), (D)], suggesting that miRNA221-3p restrains MMP1 and MMP9 expression in TMJOA synovial fibroblasts directly by targeting Ets-1. Notably, the expression of MMP3 in cells seemed to remain constant after either mimics or inhibitor transfection [Fig. 4(C)].
Regulation of miRNA221-3p and Ets-1 expression by IL-1β in TMJOA synovial fibroblasts
Our previous studies have shown that the development of TMJOA is correlated with excessive production of inflammatory stimulants, such as IL-1β
. As shown in Fig. 5(A), IL-1β suppressed miRNA221-3p in cells in both a dose-dependent (at a concentration from 0.1 to 10 ng/ml) and time-dependent manner (10 ng/ml of IL-1β at 0, 3, 6, 12, 24 h) [Fig. 5(B)]. In contrast, Ets-1 protein expression in cells was significantly elevated in a dose-dependent manner [Fig. 5(C)]. After incubation of 10 ng/ml of IL-1β for 0, 3, 6, 12, 24 h in cells, the peak of Ets-1 expression occurred at 12 h [Fig. 5(D)].
Fig. 5OA synovial fibroblast was stimulated by IL-1β for indicated periods of time with gradient doses. MiRNA and protein was extracted. A: miRNA221-3p expression after IL-1β stimulation at a different dose for 24 h. B: miRNA221-3p expression after IL-1β stimulation in different time. C: Ets-1 protein expression after IL-1β stimulation at a different dose for 24 h. D: Protein expression of Ets-1 after IL-1β stimulation in different time. Note: Values were uniformly set to a value of one initially. Values were shown as mean ± SD of n = 3 patients (three females; mean age: 21).
. MiRNA18a, which is up-regulated in rheumatoid arthritis synovial fibroblasts, accelerates cartilage destruction and chronic inflammation in the joint
. In our study, miRNA microarray was used to detect the expression profile of miRNAs in between normal and TMJOA synovial fibroblasts. The results found out that a total of 14 miRNAs were expressed with remarkable difference, including eight up-regulated and six down-regulated. Among them, miRNA221-3p was the most down-expressed in TMJOA. To our knowledge, it is the first report to detect the aberrant expression of miRNA221-3p in synovial fibroblasts from TMJOA. MiRNA221-3p was a multi-functional factor expressed in many cell types. MiRNA221-3p was reported to be an anti-angiogenic factor, namely repressing vessel formation and endothelial cells migration, in atherosclerosis
. In cancer cells, miRNA221-3p was demonstrated to regulate proliferative signaling pathways, avoid cellular death from autophagy and apoptosis, monitor angiogenesis and support epithelial–mesenchymal transition
By miRanda and TargetScanS algorithms, Ets-1 was predicted to be the possible target of miRNA221-3p. Ets-1 is a primary transcription factor in Ets family which expresses in various cell types (B cells, endothelial cells, fibroblasts and neoplastic cells)
. However, it was still unknown whether synovial fibroblasts from TMJ are capable to produce Ets-1. In this study, Ets-1 was highly expressed in TMJOA synovial fibroblasts as compared with controls and mainly distributed in both synovial lining and sublining layers. Current reports revealed that Ets-1 was targeted by miRNA221-3p to participate in vascular inflammatory response in some diseases, such as obesity
. It is of note that patterns of combination of miRNA and their target transcript are rarely specific to each cell type. For example, the expression of Tax1-binding protein 1, TNF-α-induced protein 3 and ring finger protein 11 remained unchanged after over-expression of miRNA203 in synovial fibroblasts from rheumatoid arthritis, although they were all predicted targets of miRNA203
. Hence, it was interesting to investigate whether miRNA221-3p can modulate expression of Ets-1 in TMJOA synovial fibroblasts. By means of classical gain and loss expression of miRNA221-3p, our study exhibited the regulation of miRNA221-3p on Ets-1 expression in TMJOA synovial fibroblasts. Furthermore, our dual luciferase reporter assay implied miRNA221-3p suppresses Ets-1 expression by directly binding to its 3′-UTR. Notably, cells genetically modified by the plasmid carrying Ets-1 3′-UTR still exhibited luciferase activity even after the miRNA221 mimics transfection. This phenomenon might be explained by high sensitivity of the luciferase report assay kit and the remaining luciferase value was the readout of the background.
Recent reports suggested the role of Ets-1 in inflammation and angiogenesis was by aid of its regulation of MMPs
Synovial TGF-beta1 and MMP-3 levels and their correlation with the progression of temporomandibular joint osteoarthritis combined with disc displacement: a preliminary study.
ETS-1 protein regulates vascular endothelial growth factor-induced matrix metalloproteinase-9 and matrix metalloproteinase-13 expression in human ovarian carcinoma cell line SKOV-3.
. Likewise, our findings have shown that expressions of MMP1 and MMP9 were reduced by miRNA221-3p through targeting Ets-1 in TMJOA synovial fibroblasts. MMP1 is a unique collagenase that cleaves native interstitial collagen type I, II and III
. Notably, MMP3 expression kept constant in TMJOA synovial fibroblasts after transfection. In accordance with our findings, studies of prostate cancer cells have also shown that MMP3 expression remained unchanged after Ets-1 gene was silenced
ETS1 promotes chemoresistance and invasion of paclitaxel-resistant, hormone-refractory PC3 prostate cancer cells by up-regulating MDR1 and MMP9 expression.
. Authors in that study raised the possibility of effects of other upstream pathways other than Ets-1 on the control of expression of MMP3. Indeed, current studies have demonstrated that activation of PI3k/Akt signaling pathway plays a key role in induction of MMP3 in synovial fibroblasts in rheumatoid arthritis
Resveratrol inhibits TNF-alpha-induced IL-1beta, MMP-3 production in human rheumatoid arthritis fibroblast-like synoviocytes via modulation of PI3kinase/Akt pathway.
. Hence, multiple regulations on expression of MMP3 in TMJOA synovial fibroblasts might conceal expression differences after alteration of Ets-1. Besides, researchers have observed the effect of Ets-1 on monocyte chemoattractant protein-1 (MCP-1) and IL-8 induction
Cytokine biomarkers and chronic pain: association of genes, transcription, and circulating proteins with temporomandibular disorders and widespread palpation tenderness.
. Collectively, attenuated expression of miRNA221-3p in TMJOA synovial fibroblasts initiates Ets-1 activation, accelerating extracellular matrix (ECM) degradation by up-regulation of MMP1 and MMP9 expression as well as aggravating the inflammatory status by secretion of inflamed stimulants.
IL-1β and TNF-α are the major pro-inflammatory factors that promoted the pathogenesis of TMJOA
. Previous study indicated IL-1β induced expression of more than MMPs but also other cytokines, such as IL-6, IL-8 and prostaglandin E2 in synovial fibroblasts and chondrocytes
and it exerts a crucial role in amplifying and sustaining both inflammation and joint destruction. In the present study, IL-1β reduced miRNA221-3p expression in a time and dose-dependent manner in TMJOA synovial fibroblasts. On the contrary, expression of Ets-1 was induced. These findings indicated that substantial amount of IL-1β existing in the circumstance of TMJOA accounts for the digressive expression of miRNA221-3p in synovial fibroblasts. Additionally, we also found TNF-α has repressive effect on expression of miRNA221-3p in TMJOA synovial fibroblasts (data not shown) and further study is under the investigation.
There are some limitations in this study. It is of note that although Ets-1 was up-regulated in synovial fibroblasts after incubation of IL-1β, it could not be distinguished that other pathways are involved in affecting Ets-1 expression by IL-1β except miRN221-3p. Next, the present study has demonstrated expression of miRNA221-3p and Ets-1 in synovial fibroblasts contributes to pathologic development of TMJOA patients, it would be more convincible to exhibit in vivo results.
Collectively, the reduction of miRNA221-3p in synovial fibroblasts, attributed from abundance of IL-1β in inflamed circumstance, induces Ets-1 up-regulation and then, initiates MMP1, MMP9, MCP-1 and IL-8 secretion, thereby leading to continuously pathological development in TMJOA. Therefore, miRNA221-3p, recognized as protective factor in joint, is a promising molecular target for treatment of TMJOA.
Author contributions
Dr Long and Dr Ke had full access to all of the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis.
Study design. Long, Ke.
Acquisition of data. Xu, Liu, Deng, Li, Cai, Meng, Fang.
Manuscript preparation. Long, Ke, Xu.
Statistical analysis. Ke, Xu, Liu.
Conflict of interest
We declare no conflict of interest on this manuscript.
Acknowledgments
This study was supported by grants (No. 81100769, No. 81271171, No. 81370070 and No. 81470761) from the National Science Foundation of China.
References
Wang X.D.
Zhang J.N.
Gan Y.H.
Zhou Y.H.
Current understanding of pathogenesis and treatment of TMJ osteoarthritis.
Evaluation of arthrocentesis with hyaluronic acid injection plus oral glucosamine hydrochloride for temporomandibular joint osteoarthritis in oral-health-related quality of life.
Effect of interleukin-1beta and dehydroepiandrosterone on the expression of lumican and fibromodulin in fibroblast-like synovial cells of the human temporomandibular joint.
The transcription factors hypoxia-inducible factor 1alpha and Ets-1 colocalize in the hypoxic synovium of inflamed joints in adjuvant-induced arthritis.
Synovial TGF-beta1 and MMP-3 levels and their correlation with the progression of temporomandibular joint osteoarthritis combined with disc displacement: a preliminary study.
ETS-1 protein regulates vascular endothelial growth factor-induced matrix metalloproteinase-9 and matrix metalloproteinase-13 expression in human ovarian carcinoma cell line SKOV-3.
ETS1 promotes chemoresistance and invasion of paclitaxel-resistant, hormone-refractory PC3 prostate cancer cells by up-regulating MDR1 and MMP9 expression.
Resveratrol inhibits TNF-alpha-induced IL-1beta, MMP-3 production in human rheumatoid arthritis fibroblast-like synoviocytes via modulation of PI3kinase/Akt pathway.
Cytokine biomarkers and chronic pain: association of genes, transcription, and circulating proteins with temporomandibular disorders and widespread palpation tenderness.
30143-1&id=gr1.jpg){kind=link}
30143-1&id=gr2.jpg){kind=link}
30143-1&id=gr3.jpg){kind=link}
30143-1&id=gr4.jpg){kind=link}
30143-1&id=gr5.jpg){kind=link}