Stigmasterol: a phytosterol with potential anti-osteoarthritic properties

  • Author Footnotes
    a Present address: NIH, NIAMS, CBOB, 50 South drive, Bethesda 20892, MD, USA.
    ,
    Author Footnotes
    b Authors with equal contribution.
    O. Gabay
    Footnotes
    a Present address: NIH, NIAMS, CBOB, 50 South drive, Bethesda 20892, MD, USA.
    b Authors with equal contribution.
    Affiliations
    UR-4, Pierre & Marie Curie University Paris VI, Paris Universitas, 75252 Paris Cedex 5, France
    Search for articles by this author
  • Author Footnotes
    b Authors with equal contribution.
    C. Sanchez
    Footnotes
    b Authors with equal contribution.
    Affiliations
    UR-4, Pierre & Marie Curie University Paris VI, Paris Universitas, 75252 Paris Cedex 5, France

    Bone and Cartilage Research Unit, Institute of Pathology B23, University of Liège, Sart-Tilman, 4000 Liège, Belgium
    Search for articles by this author
  • C. Salvat
    Affiliations
    UR-4, Pierre & Marie Curie University Paris VI, Paris Universitas, 75252 Paris Cedex 5, France
    Search for articles by this author
  • F. Chevy
    Affiliations
    INSERM U 538, Saint Antoine Hospital, Pierre et Marie Curie University, 75012 Paris, France
    Search for articles by this author
  • M. Breton
    Affiliations
    INSERM U 538, Saint Antoine Hospital, Pierre et Marie Curie University, 75012 Paris, France
    Search for articles by this author
  • G. Nourissat
    Affiliations
    UR-4, Pierre & Marie Curie University Paris VI, Paris Universitas, 75252 Paris Cedex 5, France

    Department of Orthopaedics, APHP Saint-Antoine Hospital, 184 rue du Fbg St Antoine, 75012 Paris, France
    Search for articles by this author
  • C. Wolf
    Affiliations
    INSERM U 538, Saint Antoine Hospital, Pierre et Marie Curie University, 75012 Paris, France
    Search for articles by this author
  • C. Jacques
    Affiliations
    UR-4, Pierre & Marie Curie University Paris VI, Paris Universitas, 75252 Paris Cedex 5, France
    Search for articles by this author
  • F. Berenbaum
    Correspondence
    Address correspondence and reprint requests to: F. Berenbaum, UR-4, UPMC Paris VI, 7 quai St Bernard, Paris 75005, France. Tel: 33-144-27-22-83; Fax: 33-144-27-51-40.
    Affiliations
    UR-4, Pierre & Marie Curie University Paris VI, Paris Universitas, 75252 Paris Cedex 5, France

    Department of Rheumatology, APHP Saint-Antoine Hospital, 184 rue du Fbg St Antoine, 75012 Paris, France
    Search for articles by this author
  • Author Footnotes
    a Present address: NIH, NIAMS, CBOB, 50 South drive, Bethesda 20892, MD, USA.
    b Authors with equal contribution.
Open ArchivePublished:October 16, 2009DOI:https://doi.org/10.1016/j.joca.2009.08.019

      Summary

      Objective

      Although most studies have focused on the cholesterol-lowering activity of stigmasterol, other bioactivities have been ascribed to this plant sterol compound, one of which is a potential anti-inflammatory effect. To investigate the effects of stigmasterol, a plant sterol, on the inflammatory mediators and metalloproteinases produced by chondrocytes.

      Method

      We used a model of newborn mouse chondrocytes and human osteoarthritis (OA) chondrocytes in primary culture stimulated with or without IL-1β (10 ng/ml), for 18 h. Cells were pre-incubated for 48 h with stigmasterol (20 μg/ml) compared to untreated cells. We initially investigated the presence of stigmasterol in chondrocyte, compared to other phytosterols. We then assessed the role of stigmasterol on the expression of various genes involved in inflammation (IL-6) and cartilage turn-over (MMP-3, -13, ADAMTS-4, -5, type II collagen, aggrecan) by quantitative Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR). Additional experiments were carried out to monitor the production of MMP-3 and prostaglandin E2 (PGE2) by specific immuno-enzymatic assays. We eventually looked at the role of stigmasterol on NF-κB activation by western blot, using an anti-IκBα antibody.

      Results

      After 18 h of IL-1β treatment, MMP-3, MMP-13, ADAMTS-4, but not ADAMTS-5 RNA expression were elevated, as well as MMP-3 and PGE2 protein levels in mouse and human chondrocytes. Type II collagen and aggrecan mRNA levels were significatively reduced. Pre-incubation of stigmasterol to IL-1β-treated cells significantly decreased these effects described above (significant reduction of MMP-3 mRNA in human and mouse, MMP-3 protein in mouse, MMP-13 mRNA in mouse and human, ADAMTS-4 mRNA in human, PGE2 protein in human and mouse) Finally, stigmasterol was capable of counteracting the IL-1β-induced NF-κB pathway.

      Conclusion

      This study shows that stigmasterol inhibits several pro-inflammatory and matrix degradation mediators typically involved in OA-induced cartilage degradation, at least in part through the inhibition of the NF-κB pathway. These promising results justify further ex vivo and in vivo investigations with stigmasterol.

      Key words

      Introduction

      Osteoarthritis (OA) is a disease that results from a dysbalance between cartilage anabolism and catabolism. This dysbalance is a result of the overexpression of pro-inflammatory mediators (Interleukin-1 (IL-1)β, tumor necrosis factor (TNF), prostaglandin E2 (PGE2), etc.) leading to the synthesis of matrix-degrading enzymes such as matrix metalloproteinase (MMP) and a desintegrin and metalloproteinase with thrombospondin motifs (ADAMTS)
      • Loeser R.F.
      Aging and osteoarthritis: the role of chondrocyte senescence and aging changes in the cartilage matrix.
      • Goldring M.B.
      • Otero M.
      • Tsuchimochi K.
      • Ijiri K.
      • Li Y.
      Defining the roles of inflammatory and anabolic cytokines in cartilage metabolism.
      • Krasnokutsky S.
      • Attur M.
      • Palmer G.
      • Samuels J.
      • Abramson S.B.
      Current concepts in the pathogenesis of osteoarthritis.
      • Attur M.
      • Al-Mussawir H.E.
      • Patel J.
      • Kitay A.
      • Dave M.
      • Palmer G.
      • et al.
      Prostaglandin E2 exerts catabolic effects in osteoarthritis cartilage: evidence for signaling via the EP4 receptor.
      • Akaogi J.
      • Nozaki T.
      • Satoh M.
      • Yamada H.
      Role of PGE2 and EP receptors in the pathogenesis of rheumatoid arthritis and as a novel therapeutic strategy.
      • Plaas A.
      • Osborn B.
      • Yoshihara Y.
      • Bai Y.
      • Bloom T.
      • Nelson F.
      • et al.
      Aggrecanolysis in human osteoarthritis: confocal localization and biochemical characterization of ADAMTS5-hyaluronan complexes in articular cartilages.
      . The overexpression of catabolic enzymes by pro-inflamatory mediators is mediated by a set of pro-inflammatory signaling pathways. Among them, the activation of nuclear factor-κB (NF-κB)
      • Khanna D.
      • Sethi G.
      • Ahn K.S.
      • Pandey M.K.
      • Kunnumakkara A.B.
      • Sung B.
      • et al.
      Natural products as a gold mine for arthritis treatment.
      , is critical in the pathophysiology of OA
      • Aggarwal B.B.
      • Takada Y.
      • Shishodia S.
      • Gutierrez A.M.
      • Oommen O.V.
      • Ichikawa H.
      • et al.
      Nuclear transcription factor NF-kappa B: role in biology and medicine.
      • Aggarwal B.B.
      Nuclear factor-kappaB: the enemy within.
      . Thus, agents that suppress the expression of IL-1β, pro-inflammatory mediators, MMP or suppress the activation of NF-κB, have potential for the treatment of OA.
      Numerous agents derived from plants can suppress cell signaling intermediates: Kasinski et al. have shown that an analog of curcumin inhibits the NF-κB pathway
      • Kasinski A.L.
      • Du Y.
      • Thomas S.L.
      • Zhao J.
      • Sun S.Y.
      • Khuri F.R.
      • et al.
      Inhibition of IkappaB kinase-nuclear factor-kappaB signaling pathway by 3,5-bis(2-flurobenzylidene)piperidin-4-one (EF24), a novel monoketone analog of curcumin.
      . Aggarwal et al. have studied the inhibition of the NF-κB pathway by inhibiting cyclooxygenase-2 (Cox-2) and CyclinD1 protein production, by other than non-steroidal anti-inflammatory agents (NSAID) anti-inflammatory agents, as resveratrol or curcumin. Interestingly, these compounds are the most potent anti-inflammatory and anti-proliferative agents of those they studied
      • Aggarwal B.B.
      • Shishodia S.
      Suppression of the nuclear factor-kappaB activation pathway by spice-derived phytochemicals: reasoning for seasoning.
      . Tea polyphenols inhibit IL-β stimulated MMP-1 and -13 through the NF-κB and activator protein (AP)-1 pathways in human chondrocytes
      • Ahmed S.
      • Wang N.
      • Lalonde M.
      • Goldberg V.M.
      • Haqqi T.M.
      Green tea polyphenol epigallocatechin-3-gallate (EGCG) differentially inhibits interleukin-1 beta-induced expression of matrix metalloproteinase-1 and -13 in human chondrocytes.
      . Guggulsterone, a plant sterol, inhibits NF-κB signaling by blocking Inhibitor of kappa B (I-κB) kinase and ameliorates acute murine inflammation
      • Cheon J.H.
      • Kim J.S.
      • Kim J.M.
      • Kim N.
      • Jung H.C.
      • Song I.S.
      Plant sterol guggulsterone inhibits nuclear factor-kappaB signaling in intestinal epithelial cells by blocking IkappaB kinase and ameliorates acute murine colitis.
      . Shishodia and Aggarwal have shown that guggulsterone decreases MMP-9 and COX-2 expression, inhibits the NF-κB pathway, and reduces apoptosis in different cell lines
      • Shishodia S.
      • Aggarwal B.B.
      Guggulsterone inhibits NF-kappaB and IkappaBalpha kinase activation, suppresses expression of anti-apoptotic gene products, and enhances apoptosis.
      . It is well known that all these factors play an important role in arthritis.
      Boswellic acid, an extract from boswellia resin, a major anti-inflammatory agent in herbal traditional medicine, has been shown to inhibit tumor necrosis factor (TNF)-alpha-mediated NF-κB activation, but not c-Jun-Nterminal Kinase (JNK) or p38 mitogen activated protein (MAP) kinases
      • Moussaieff A.
      • Shohami E.
      • Kashman Y.
      • Fride E.
      • Schmitz M.L.
      • Renner F.
      • et al.
      Incensole acetate, a novel anti-inflammatory compound isolated from Boswellia resin, inhibits nuclear factor-kappa B activation.
      . The Indian ginseng, or Withania somnifera Dunal (Ashwagandha), is used in ayurvedic medicine to treat arthritis or inflammation. Ichikawa et al. have shown that Withanolides inhibits NF-κB, IL-1β or TNF-alpha stimulated, as well as COX-2 gene products in inflammation
      • Ichikawa H.
      • Takada Y.
      • Shishodia S.
      • Jayaprakasam B.
      • Nair M.G.
      • Aggarwal B.B.
      Withanolides potentiate apoptosis, inhibit invasion, and abolish osteoclastogenesis through suppression of nuclear factor-kappaB (NF-kappaB) activation and NF-kappaB-regulated gene expression.
      . Boswellic acid treatment in herbal traditional medicine, has a robust anti-inflammatory effect in a mouse inflamed paw model
      • Moussaieff A.
      • Shohami E.
      • Kashman Y.
      • Fride E.
      • Schmitz M.L.
      • Renner F.
      • et al.
      Incensole acetate, a novel anti-inflammatory compound isolated from Boswellia resin, inhibits nuclear factor-kappa B activation.
      .
      Phytosterols or plant sterols are fatty acids contained in plants. Their chemical structure is very close to cholesterol, the most common animal fatty acid. Little is known about the role of phytosterols in cartilage, and their therapeutic role in arthritis
      • Khanna D.
      • Sethi G.
      • Ahn K.S.
      • Pandey M.K.
      • Kunnumakkara A.B.
      • Sung B.
      • et al.
      Natural products as a gold mine for arthritis treatment.
      . However, as soon as 1953, Thiers discussed the value of stigmasterol as an anti-stiffness factor in the therapy of rheumatic diseases, as shown in guinea pigs experiments
      • Thiers H.
      . After the administration of a compound composed of three phytosterols, paw edema and neutrophil infiltration were decreased in inflamed tissues, as well as the level of superoxide ions, within an adjuvant-induced arthritis mouse model
      • Navarro A.
      • De las Heras B.
      • Villar A.
      Anti-inflammatory and immunomodulating properties of a sterol fraction from Sideritis foetens Clem.
      . Bouic et al. have tested runners consuming beta-sitosterol and shown that some immuno-parameters were increased while IL-6 was decreased in the circulation, suggesting a lower inflammatory response
      • Bouic P.J.
      • Clark A.
      • Lamprecht J.
      • Freestone M.
      • Pool E.J.
      • Liebenberg R.W.
      • et al.
      The effects of B-sitosterol (BSS) and B-sitosterol glucoside (BSSG) mixture on selected immune parameters of marathon runners: inhibition of post marathon immune suppression and inflammation.
      • Bouic P.J.
      • Lamprecht J.H.
      Plant sterols and sterolins: a review of their immune-modulating properties.
      . Given that phytosterols have a potent anti-inflammatory effect, we investigated their effect on chondrocyte metabolism in term of expression of inflammatory and degradative markers.

      Material and methods

       Primary cell culture

      All experiments were performed according to protocols approved by the French/European ethics committee.
      • -
        Mouse cartilage was obtained after dissection of three different litters of 12 newborn swiss mouse rib, 5–6 days old
        • Lefebvre V.
        • Garofalo S.
        • Zhou G.
        • Metsaranta M.
        • Vuorio E.
        • De Crombrugghe B.
        Characterization of primary cultures of chondrocytes from type II collagen/beta-galactosidase transgenic mice.
        • Salvat C.P.A.
        • Humbert L.
        • Berenbaum F.
        • Thirion S.
        Immature murine articular chondrocytes in primary culture: a new tool for investigating cartilage.
        . We obtained chondrocytes after digestion with collagenase D, 3 mg/mL (Roche Diagnostics, Meylan, France) for 1 h 30 min at 37°C in rotation and a following overnight incubation at 0,5 mg/mL. Chondrocytes were grown to confluence in Dulbecco's Modified Eagle's Medium (DMEM) 1 g/L glucose (Sigma–Aldrich, St Quentin-Fallavier, France) supplemented with 10% foetal calf serum (Invitrogen, Eragny, France), 60 U/ml penicillin, 60 μg/ml streptomycin and 2 mmol/l glutamine (Sigma) at 37°C with 6% CO2. In each experiment, cells were made quiescent for 24 h in DMEM medium without serum and with bovine albumin fatty acid free (Sigma). Cells were pre-incubated with 20 μg/mL of stigmasterol (Fluka, Sigma–Aldrich, Germany), dissolved in ethanol during 48 h in DMEM without serum. As a control, cells were incubated within the equivalent volume of ethanol (0.1% final). These compounds were maintained during the whole period of incubation. Then, cells were stimulated with or without rIL-1β, 10 ng/mL (PeproTech, Rocky Hill, NJ) for 0–10 min and for 18 h, in 10 cm plates in duplicate.
      • -
        Human osteoarthritic cartilage was obtained after total knee replacement from three different human samples. The average age was 66 years, range 59–80 years. Cartilage was dissected into small fragments and submitted to sequential enzymatic digestions with hyaluronidase, pronase and collagenase adapted from Sanchez et al.
        • Sanchez C.
        • Mathy-Hartert M.
        • Deberg M.A.
        • Ficheux H.
        • Reginster J.Y.
        • Henrotin Y.E.
        Effects of rhein on human articular chondrocytes in alginate beads.
        . Chondrocytes were plated in DMEM (4.5 g/l glucose) (Sigma–Aldrich, St Quentin-Fallavier, France) supplemented with 10% foetal calf serum (Invitrogen, Eragny, France), 100 U/ml penicillin, 0.1 mg/ml streptomycin, 2 mmol/l l-glutamine (Sigma) at 37°C with 6% CO2. Cells were made quiescent for 24 h in DMEM medium without serum and with 2% bovine albumin fatty acids free (Sigma). Cells were pre-incubated with 20 μg/ml of stigmasterol, as previously described. Then, cells were stimulated with or without human rIL-1β 10 ng/ml (PeproTech, Rocky Hill, NJ) during 18 h in 10 cm plates in duplicate. Cells incubated with 0.1% ethanol alone served as control.

       Detergent-Resistant Membranes (DRM) preparation

      Cholesterol, epicoprostanol (5beta-cholestan-alpha-ol), campesterol, stigmasterol and beta-sitosterol were obtained from Sigma (Saint Quentin-Fallavier, France). Analytical grade solvents were obtained from Aldrich. The silylation reagent (Regisil® +10% TrimethylchloroSilane) was obtained from Interchim (Montluçon, France).
      DRM were prepared on ice according to the method of Bligh and Dyer
      • Bligh E.G.
      • Dyer W.J.
      A rapid method of total lipid extraction and purification.
      . Briefly, DRM were separated from detergent-solubilised membranes and from soluble proteins by ultracentrifugation on a discontinuous (40, 35 and 5%) sucrose gradient (in a Beckman SW41 rotor). DRM were recovered in fractions 4–6, at the interface between the 5% layer and the 30 or 35% layer. After vigorous mixing, the 40% layer was considered to be the soluble fraction. The fractions were mixed with six volumes of chloroform-methanol 2/1 (v/v) containing epicoprostanol as the internal standard. Lipids were partitioned in the lower chloroform phase after addition of saline. After transfer and evaporation of chloroform, the esterified lipids were saponified by methanolic potassium hydroxide. Released fatty acids were methyled by Boron Trifluoride (BF3)-methanol in order to not interfere with the chromatographic separation of silylated sterols. The sterols were extracted with cyclohexane and silylated by Bis-trimethylsilsyl-trifluoroacetamide (BSTFA)– Trimethylchlorosilane (TMCS) 10%. Analysis by gas chromatography–mass spectrometry (GC–MS): the derivatives of sterols were separated by GC (Hewlett–Packard) on a medium polarity capillary column provided by Restek (Evry, France). The temperature was maintained for 10 min at 285°C. Injector and detector temperatures were at 260°C. Helium was used as the carrier gas. The mass spectrometer (Hewlett–Packard) in series with the GC chromatograph was set up for detection of positive ions. Ions were produced in the electron impact mode at 70 eV. The sterols were identified by the fragmentogram in the scanning mode and quantified by selective monitoring of the specific ions after normalisation with the internal standard epicoprostanol and calibration with weighed standards. The ions (m/z) used for analysis were: cholesterol, 458, 329; campesterol, 472, 382; stigmasterol, 484, 394 and beta-sitosterol, 486, 396.

       Preparation of cytosolic extracts

      Cytosolic extracts were obtained from culture cells. Chondrocytes were washed in Phosphate Buffer Saline (PBS) and re-suspended in buffer TLB (Tris–HCl pH 7.6 20 mM; NaCl 150 mM; ethylenediaminetetraacetic acid (EDTA) pH 8 2 mM; triton 1%; Glycerol 10%; complete 25×; orthovanadate 2 mM) and homogenized at +4°C for 30 min. Then, cells were vortexed and centrifugated at 13,000×g for 10 min at +4°C. The cytosolic fractions (supernatants) were separated and stored at −80°C until analysis. Protein concentration was determined by the bicinchoninic acid assay kit (BCA Pierce, Interchim, Montluçon, France), according to the manufacturers instructions.

       Western-blot analysis

      For IκBα, cytosolic fractions were obtained as described above. Then, similar amounts of proteins (10 μg) were run on Sodium dodecyl Sulfate (SDS)-polyacrylamide gel by electrophoresis and were transferred to polyvinylidene difluoride membranes (PVDF) with kaleidoscope prestained standards (Bio-Rad Ivry sur Seine, France). Membranes were blocked in 0.1 mmol/l Tris, pH 7.6, and 0.1 mmol/l NaCl containing 0,1% Tween-20 and 5% dry skimmed milk or bovine serum albumin (BSA) for 60 min at room temperature. Then, membranes were incubated overnight with anti-IκBα antibody (Santa Cruz, Tebu-bio, Le Perray en Yvelines, France) at 4°C. After washing, detections were made by incubation with peroxidase-conjugated secondary antibodies and developed by an enhanced chemiluminiscence kit (ECL, Amersham, Pharmacia biotec, Orsay, France), and exposed to Kodak Biomax mRNA (MR)-1 films. In order to ensure that equal amounts of total proteins were loaded, we also hybridized each membrane with anti-β-actin (Sigma–Aldrich, St Quentin-Fallavier, France).

       RNA extraction and Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)

      Total RNA was extracted from each sample using the RNeasy Mini Kit (Qiagen,GmbH, Hilden, Germany), according to the manufacturer's instructions. A DNAse digestion step (RNAse free DNAse set, Qiagen) was added. RNA concentration was then measured using a spectrophotometer. The migration in an agarose gel enabled quality control. Total RNA (1 μg) was reverse transcribed with Omniscript Kit (Qiagen GmbH, Hilden, Germany) in a final volume of 20 μL containing 50 ng of oligos dT. The enzyme was then inactivated by heating and the cDNAs of interest (hypoxanthine-guanine phosphoribosyltransferase (HPRT), MMP-1, MMP-3, MMP-13, ADAMTS-4, ADAMTS-5, IL-6) were quantified by real-time quantitative PCR using the LC480 LightCycler* RT-PCR (Roche) and Fast Start DNA master plus registred (SYBR green) kits (Roche). Sense and antisense PCR primers were designed by the LightCycler probe design*software, based on mouse and human sequence information (Table I). The PCR reactions were performed in a 12 μl final volume using 0.2 μl of cDNA or, 600 ng of specific primers and 1×Fast Start DNA master plus SYBR mixture (Roche). PCR amplification conditions were as follows: initial denaturation for 5 min at 95°C followed by 40 cycles consisting of 10 s at 95°C, 15 s at 60°C and 10 s at 72°C. The generation of specific PCR products was confirmed by melting-curve analysis. For each real-time RT-PCR run, cDNAs were run in triplicate in parallel with serial dilutions of a purified DNA standard (from 106 to 103 copies) for each primer pair to generate a linear standard curve, which was used to estimate relative quantities of genes of interest normalized for HPRT in the sample.
      Table ISequences of primers for the quantitative RT-PCR experiments
      Human geneSenseSequence 5′ → 3′Size (pb)
      HPRTFTGTAATGACCAGTCAACAGGG104
      RCCAGTGTCAATTATATCTTCCACAATC
      MMP-3FCCCAAGAGGCATCCAC264
      R5′GGGTCAAACTCCAACTGT
      MMP-13FCAACGGACCCATACAG376
      RACAGACCATGTGTCCC
      ADAMTS-4F5′AGAAGAAGTTTGACAAGTGC225
      R5′GCGTGTATTCACCATTGAG
      ADAMTS-5F5′ATCACCCAATGCCAAGG246
      R5′AGCAGAGTAGGAGACAAC
      IL-6F5′CAATGAGGAGACTTGCCTGG113
      R5′GCACAGCTCTGGCTTGTTCC
      AGGF5′TCTACCTCTGCGGTAGGG154
      R5′GGAAGTTCACTGACATCCTCTAT
      Col2F5′GGATGCCACACTCAAG216
      R5′TTGGGGTAGACGCAAG
      Mouse geneSenseSequence 5′ → 3′Size (pb)
      HPRTFAGG ACC TCT CGA AGT GT111
      RATT CAA ATC CCT GAA GTA CTCAT
      MMP-3FATG AAA ATG AAG GGT CTT CCG G108
      RGCA GAA GCT CCA TAC CAG CA
      MMP-13FTGA TGG CAC TGC TGA CAT CAT173
      RTGT AGC CTT TGG AAC TGC TT
      ADAMTS-4F5′GGC AAG GAC TAT GAC GC155
      RTCA GCC CAA GGT GAG TG
      ADAMTS-5FTCA GCC ACC ATC ACA GAA161
      RCCA GGG CAC ACC GAG TA
      IL-6FGTC ACA GAA GGA G5G GCTA193
      RAGA GAA CAA CAT AAG TCA GAT ACC
      AGGF5′CAGATTAGTGGAGGGTGTGA152
      R5′AGACCCTGGGAAGTTTGT
      Col2F5′GGC AAC AGC AGG TTC ACA TA131
      R5′ATG GGT GCG ATG TCA ATA AT

       PGE2 assay

      PGE2 production was measured in the media by a high sensitivity enzyme immuno-assay kit (EIA, Cayman chemical, Ann Arbor, MI, USA) according to the manufacturer's instructions. The limit of detection was 9 pg/ml. PGE2 concentration was analysed at serial dilutions in duplicate and read against standard curve.

       MMP-3 protein assay

      MMP-3 protein production was measured in the media by an enzyme linked immunoabsorbant assay (ELISA) (Mouse or Human MMP-3 total Quantikine Immuno-assay, R&D systems Minneapolis, Minnesota) according to the manufacturer's instructions. MMP-3 concentration were analysed in triplicate.

       Biochemical analysis: measurement of lactate deshydrogenase (LDH)

      Cell mortality is evaluated by measurement of LDH in the supernatant of the cultures. Fifty microliters of buffer Tris 10 mM, pH 8.5, containing 10 mg/ml of bovine serum albumin were mixed with 100 μl of standard or samples (before freezing). Then, 50 μl of reaction mix, composed by piodonitrotetrazolium violet (1.6 mg/ml) nicotinamide-adenine-dinucleotide (4 mg/ml) and phenazine methosulphate (0.4 mg/ml) was added. After 10 min incubation at room temperature, absorbance was read at 492 nm. A standard curve was obtained using LDH isolated from rabbit muscle at a concentration ranging from 12.5 to 2000 ng/ml. Percent of dead cells was calculated using following formula: (LDH of culture medium/total LDH)×100. (BSA, piodonitrotetrazolium and Molecular weight (PM) are from Sigma–Aldrich, Bornem, Belgium; Nicotinamide Adenine Dinucleotide (NAD) and LDH isolated from rabbit muscle are from Roche pharmaceuticals, Brussels, Belgium).

       Statistical analysis

      Results are expressed as the mean and standard deviation (SD). All analysis were performed with Prism (Prism, GraphPad Software Inc, San Diego, CA).
      The mean and SD of two populations were compared with unpaired t tests, assuming unequal variances. For multiple comparisons, depending on the experiment, one way or two ways analysis of variance (ANOVA) were performed before posttests, assuming Gaussian distribution.
      For % of inhibition on Western Blot films, we used Genesnap and Genetools software, in the syngene system (Cambridge, UK). We previously assigned 100% of intensity to the controls, and the device calculated the % of intensity of the other bands, compared to controls.
      All western blots were repeated three times to verify consistency. The representative results are presented in figures.

      Results

       Stigmasterol binds to the chondrocyte membrane DRM (detergent resistant membrane) at a higher level compared to sitosterol and campesterol

      When chondrocytes were pre-incubated with the same amount of the three phytosterols (20 μg/ml) i.e., stigmasterol, sitosterol and campesterol, they were found upon chondrocyte membranes in different amount, bind to the chondrocyte membrane [Fig. 1(A)]. Stigmasterol was able to bind the membrane at a higher level than the two others (2-fold compared to campesterol, and 1.8-fold compared to sitosterol). When pre-incubated alone, stigmasterol is found in 74% of chondrocyte DRM (data not shown), and more particularly in fractions 4–6, insoluble membranes or lipid rafts, obtained after sucrose gradient extraction from the method described by Bligh and Dyer
      • Bligh E.G.
      • Dyer W.J.
      A rapid method of total lipid extraction and purification.
      Fractions 4, 5 and 6 are established as detergent resistant membranes known as lipid rafts, and fractions 711 as soluble membranes [Fig. 1(B)].
      Figure thumbnail gr1
      Fig. 1(A) Stigmasterol is preferentially found in chondrocyte membranes as compared to three different sterols. Mouse costal chondrocytes were cultured and grown to confluence and serum starved from 24 h followed by 20 μg/ml stigmasterol, campesterol or sistosterol pre-incubation during 48 h. At the end of the incubation, cells were washed and collected to 250 μl of PBS. This homogenate is sonicated in order to break the cell membranes and analysed by mass spectrometry after lipid extraction. This graph represents the mean and the SD obtained from two independent experiments. A two ways ANOVA was performed before posttests (Bonferroni multiple comparison test), ***P<0.0001. (B) Stigmasterol is found in lipid rafts of chondrocyte membrane. Mouse costal chondrocytes were cultured and grown to confluence and serum starved from 24 h followed by 20 μg/ml stigmasterol pre-incubation during 48 h. At the end of the incubation, cells were washed and collected to 250 μl of PBS. This homogenate was sonicated to disrupt the cell membrane and was following subjected to mass spectrometry. Analysis was then carried out according to M&M. The graph represents the mean and the SD obtained from three independent experiments One way ANOVA was performed before posttests (Mann–Whitney test) We compared the insoluble group (fract. 4–6) with the soluble group (fract. 7–11). ***P=0.0007.
      On a western blot performed with the same fractions, using an anti Cav 1 antibody (Mouse Anti-Caveolin-1 Monoclonal Antibody, Clone 2297. BD Biosciences) we found Caveolin-1 protein in fraction 4, 5 and 6 (data not shown).
      After identifying that stigmasterol had a better affinity to bind chondrocyte membranes, we carried out a concentration-dependent incubation with this sterol, ranging from 0 to 80 μg/ml (0, 10, 20, 40, 60, 80 μg). Forty μg/ml represented the maximum dose for stigmasterol binding in chondrocyte. This amount of stigmasterol in chondrocyte did not affect the amount of membrane cholesterol as measured by mass spectrometry. Additionally, none of the concentrations affected cell viability, as determined by LDH assay (data not shown). We have then chosen to study the role of stigmasterol at the concentration of 20 μg/ml in chondrocyte.
      To reproduce inflammation conditions, we stimulate our cell culture with IL-1β (10 ng/ml) during 18 h after pre-incubation of stigmasterol during 48 h.

       IL-1β stimulated PGE2 release

      IL-1β stimulation (10 ng/ml) for 18 h leads to an increase of PGE2 release of 151-fold in human chondrocytes (P<0.0001), and 18-fold in mouse chondrocytes (P<0.001). When stigmasterol (20 μg/ml) is pre-incubated for 48 h in starving conditions before IL-1β treatment, the effect of IL-1β on PGE2 production is decreased by 2-fold in human chondrocytes (P=0.001) and 1.3-fold in mice chondrocytes (P<0.05) [Fig. 2(A, B)].
      Figure thumbnail gr2
      Fig. 2(A) Stigmasterol inhibits PGE2 release after IL-1β stimulation in mouse chondrocytes. Mouse chondrocytes were cultured and grown to confluence and serum starved from 24 h followed by 20 μg/ml stigmasterol pre-incubation during 48 h. At the end of the incubation, IL-1β (10 ng/ml) was added in the culture media, for 18 h. This graph represents the mean and the SD of data from three independent experiments performed in duplicate. Results are expressed in pg/ml. The mean and the SD of the two populations were compared with unpaired t tests, assuming unequal variances. **P=0.0016 and *P=0.0177. (B) Stigmasterol inhibits PGE2 release after IL-1β stimulation in human chondrocytes. Human chondrocytes were cultured and grown to confluence and serum starved from 24 h followed by 20 μg/ml stigmasterol pre-incubation during 48 h. At the end of the incubation, IL-1β (10 ng/ml) was added in the culture media, for 18 h. This graph represents the mean and the SD of data from three independent experiments performed in duplicate. Results are expressed in pg/ml. The mean and the SD of the two populations were compared with unpaired t tests, assuming unequal variances. ***P<0.0001 and *P=0.0115. (C) Stigmasterol inhibits basal PGE2 production in a concentration-dependent manner. Human chondrocytes were cultured and grown to confluence and serum starved from 24 h followed by a range of increased concentrations, in μg/ml of stigmasterol pre-incubation for 48 h (5, 10, 20, 40, 80). This graph represents the mean and the SD of data from three independent experiments performed in duplicate (n=6), at 24 h. Results are expressed in ng/μg of DNA; One way ANOVA was performed before posttests (Kruskal–Wallis), *P=0.0106.
      When stigmasterol is increased in concentration (5, 10, 20, 40, 80 μg/ml) and pre-incubated for 48 h, basal PGE2 production is decreased until 2-fold in human chondrocytes (P<0.05) in a concentration-dependent manner [Fig. 2(C)].

       Stigmasterol decreases IL-1β stimulated MMP-3 gene expression and protein production

      Stimulation with IL-1β (10 ng/ml) for 18 h leads to 26-fold increase of MMP-3 gene expression in mouse (P<0.0001), and 3.3-fold increase in human chondrocytes (P=0.0362). When stigmasterol (20 μg/ml) is pre-incubated during 48 h before the IL-1β treatment, MMP-3 gene expression decreases by 6-fold in mouse chondrocytes (P<0.0001) and by 4.5-fold in human chondrocytes (P=0.0493) [Fig. 3(A, B)].
      Figure thumbnail gr3
      Fig. 3Stigmasterol inhibits MMP-3 gene expression and MMP-3 protein release after IL-1β stimulation in mouse chondrocytes, and MMP-3 gene expression in human chondrocytes. (A) MMP-3 gene expression was decreased in presence of stigmasterol and IL-1β. Mouse chondrocytes were cultured and grown to confluence and serum starved from 24 h followed by 20 μg/ml stigmasterol pre-incubation during 48 h. At the end of the incubation, IL-1β (10 ng/ml) was added in the culture media, for 18 h. This graph represents the mean and the SD of data from three different experiments performed in duplicate. Results are expressed as a ratio between MMP-3 mRNA and HPRT (an house keeping gene) mRNA. The mean and the SD of the two populations were compared with unpaired t tests, assuming unequal variances. ***P<0.0001 and ***P=0.001. (B) MMP-3 gene expression was decreased in presence of stigmasterol and IL-1β. Human chondrocytes were cultured and grown to confluence and serum starved from 24 h followed by 20 μg/ml stigmasterol pre-incubation during 48 h. At the end of the incubation, IL-1β (10 ng/ml) was added in the culture media, for 18 h. This graph represents the mean and the SD of data from three different experiments performed in duplicate. Results are expressed as a ratio between MMP-3 mRNA and HPRT (a house keeping gene) mRNA. The mean and the SD of the two populations were compared with unpaired t tests, assuming unequal variances. *P=0.0362 and *P=0.0493. (C) Stigmasterol inhibits MMP-3 protein release after IL-1β stimulation in mouse chondrocytes. Mouse chondrocytes were cultured and grown to confluence and serum starved from 24 h followed by 20 μg/ml stigmasterol pre-incubation for 48 h. At the end of the incubation, IL-1β (10 ng/ml) was added in the culture media, during 18 h. This graph represents the mean and the SD of data from three independent experiments performed in duplicate. Results are expressed in ng/ml. The mean and the SD of the two populations were compared with unpaired t tests, assuming unequal variances. *P=0.0109 and *P=0.0176. (D) Stigmasterol has no effect on MMP-3 protein release after IL-1β stimulation in human chondrocytes. Human chondrocytes were cultured and grown to confluence and serum starved from 24 h followed by 20 μg/ml stigmasterol pre-incubation for 48 h. At the end of the incubation, IL-1β (10 ng/ml) was added in the culture media, during 18 h. This graph represents the mean and the SD of data from three independent experiments performed in duplicate. Results are expressed in ng/ml. The mean and the SD of the two populations were compared with unpaired t tests, assuming unequal variances. *P=0.0394 and P=0.118, Not Significant (NS).
      IL-1β stimulation (10 ng/ml) during 18 h leads to a 14-fold increase of MMP-3 release in the media of mouse chondrocytes (P=0.0109) and 1.6-fold increase in the media of human chondrocytes (P=0.0394). However, when stigmasterol (20 μg/ml) is pre-incubated for 48 h before IL-1β treatment, IL-1β stimulated MMP-3 production was decreased by 4.25-fold in mouse (P=0.0176) but not significantly in human [Fig. 3(C, D)].

       Stigmasterol decreases MMP-13 gene expression following IL-1β stimulation

      Stimulation with IL-1β (10 ng/ml) for 18 h leads to a 6-fold increase of MMP-13 gene expression in mouse chondrocytes (P=0.0071) and 34-fold increase in human chondrocytes (P<0.001). Upon addition of stigmasterol (20 μg/ml) during 48 h before the IL-1β treatment, MMP-13 gene expression is decreased by 7-fold in mouse (P=0.0009) and by 4-fold in human chondrocytes (P=0.0187) [Fig. 4(A, B)].
      Figure thumbnail gr4
      Fig. 4Stigmasterol inhibits IL-1β stimulated MMP-13 gene expression in mouse and human chondrocytes. (A) Mouse chondrocytes were cultured and grown to confluence and serum starved from 24 h followed by 20 μg/ml stigmasterol pre-incubation during 48 h. At the end of the incubation, IL-1β (10 ng/ml) was added in the culture media, for 18 h. This graph represents the mean and the SD of data from three independent experiments performed in duplicate. Results are expressed as a ratio between MMP-13 mRNA and HPRT mRNA. The mean and the SD of the two populations were compared with unpaired t tests, assuming unequal variances. **P=0.0071 and ***P=0.0009. (B) Human chondrocytes were cultured and grown to confluence and serum starved from 24 h followed by 20 μg/ml stigmasterol pre-incubation during 48 h. At the end of the incubation, IL-1β (10 ng/ml) was added in the culture media, for 18 h. This graph represents the mean and the SD of data from three independent experiments performed in duplicate. Results are expressed as a ratio between MMP-13 mRNA and HPRT mRNA. The mean and the SD of the two populations were compared with unpaired t tests, assuming unequal variances. ***P<0.0001 and *P=0.0187.

       Stigmasterol decreases ADAMTS-4 gene expression following IL-1β stimulation, but ADAMTS-5 gene expression is unaffected by both IL-1β stimulation or stigmasterol pre-incubation

      Stimulation with IL-1β (10 ng/ml) for 18 h leads to a 2.5-fold increase of ADAMTS-4 gene expression in mouse (NS) and 3-fold increase in human chondrocytes (P<0.0001). When stigmasterol (20 μg/ml) was pre-incubated during 48 h before the IL-1β treatment, ADAMTS-4 gene expression was decreased by 1.8-fold in mouse chondrocytes (P=0.0156), and by 4.2-fold in human chondrocytes (P<0.0001).
      However, mouse RNA levels of ADAMTS-5 were unaffected nor by IL-1β stimulation, nor by stigmasterol incubation before IL-1β stimulation, as compared to untreated controls. The same profile was observed in human chondrocytes [Fig. 5(B, D)].
      Figure thumbnail gr5
      Fig. 5ADAMTS-4 gene expression is inhibited by stigmasterol in human chondrocytes. (A) Mouse chondrocytes were cultured and grown to confluence and serum starved from 24 h followed by 20 μg/ml stigmasterol pre-incubation during 48 h. At the end of the incubation, IL-1β (10 ng/ml) was added in the culture media, during 18 h. This graph represents the mean and the SD of data from three independent experiments performed in duplicate. Results are presented as a ratio between ADAMTS-4 mRNA and HPRT mRNA. The mean and the SD of the two populations were compared with unpaired t tests, assuming unequal variances. P=0.103, NS and *P=0.0156 [(A)]. (B) Stigmasterol has no effect on ADAMTS-5 gene expression in mouse or human chondrocytes. Mouse [(B)] or human [(D)] chondrocytes were cultured and grown to confluence and serum starved from 24 h followed by 20 μg/ml stigmasterol pre-incubation during 48 h. At the end of the incubation, IL-1β (10 ng/ml) was added in the culture media, during 18 h. This graph represents the mean and the SD of data from three independent experiments performed in duplicate. Results are presented as a ratio between ADAMTS-5 mRNA and HPRT mRNA. The mean and the SD of the two populations were compared with unpaired t tests, assuming unequal variances. (C) Human chondrocytes were cultured and grown to confluence and serum starved from 24 h followed by 20 μg/ml stigmasterol pre-incubation during 48 h. At the end of the incubation, IL-1β (10 ng/ml) was added in the culture media, during 18 h. This graph represents the mean and the SD of data from two independent experiments performed in duplicate. Results are presented as a ratio between ADAMTS-4 mRNA and HPRT mRNA. The mean and the SD of the two populations were compared with unpaired t tests, assuming unequal variances. ***P<0.0001 and ***P<0.001.

       Stigmasterol had no effect on IL-6, aggrecan and Col2 gene expression in chondrocytes

      IL-1β stimulation (10 ng/ml) during 18 h lead to a 256-fold increase of IL-6 gene expression in mouse chondrocytes and a 20-fold increase in human chondrocytes. Pre-incubation of stigmasterol (20 μg/ml) during 48 h to IL-1β stimulated cells did not affect gene expression levels of IL-6 gene expression compared to the same culture IL-1β stimulated in mouse or human chondrocytes (data not shown).
      When cells were stimulated with IL-1β (10 ng/ml), a 7.3-fold decrease of aggrecan and a 4-fold decrease of Col2 gene expression was observed in mouse chondrocytes. However stigmasterol (20 μg/ml) pre-incubation with IL-1β did not affect these RNA levels, compared to controls stimulated with IL-1β alone. The same profile was observed in human chondrocytes (data not shown).

       Stigmasterol inhibits I-κB degradation following IL-1β stimulation

      Treatment of mouse chondrocytes with IL-1β (10 ng/ml) caused a rapid inhibition of cytosolic I-κBα expression, from 7 min (2.6-fold, P<0.0001) to 10 min (3.2-fold, P<0.0001) post IL-1β exposure. This effect on I-κBα expression was reversed when stigmasterol was pre-incubated during 48 h before IL-1β stimulation (20 μg/ml) at 7 and 10 min (P<0.0001) [Fig. 6(A, B)].
      Figure thumbnail gr6
      Fig. 6I-κB expression in chondrocytes. (A) The IL-1β-induced inhibition of cytosolic I-κBα expression is counteracted by stigmasterol in costal chondrocytes. Mouse chondrocytes were cultured and grown to confluence and serum starved for 24 h followed by 20 μg/ml stigmasterol pre-incubation during 48 h. Then, cells were incubated in presence or absence of IL-1β (10 ng/ml) for 0–10 min. Cytosolic extracts were electrophorezed under reducing, denaturing conditions, stained with affinity-purified anti-I-κBα antibody and βactin, and visualized by enhanced chemiluminiscence. The figure presents data from one of three independent experiments that produced similar results. (B) Quantification of results presented in A. A one way ANOVA was performed before posttests (Bonferroni multiple comparison test) ***P<0.0001. The values were obtained after normalizing the band intensity to beta-actin.

      Discussion

      The previous interest of examining the action of phytosterols on cardiovascular diseases lead to seek the potent anti-inflammatory properties of these compounds
      • Van Horn L.
      Diet and heart disease: continuing contributions.
      • Wlodarek D.
      • Naruszewicz M.
      • Kozlowska-Wojciechowska M.
      Plant sterols beyond low-density lipoprotein-cholesterol.
      • Patch C.S.
      • Tapsell L.C.
      • Williams P.G.
      • Gordon M.
      Plant sterols as dietary adjuvants in the reduction of cardiovascular risk: theory and evidence.
      • Calpe-Berdiel L.
      • Escola-Gil J.C.
      • Rotllan N.
      • Blanco-Vaca F.
      Phytosterols do not change susceptibility to obesity, insulin resistance, and diabetes induced by a high-fat diet in mice.
      . But little is known concerning the impact of these compounds in arthritis
      • Khanna D.
      • Sethi G.
      • Ahn K.S.
      • Pandey M.K.
      • Kunnumakkara A.B.
      • Sung B.
      • et al.
      Natural products as a gold mine for arthritis treatment.
      .
      The first pharmacological question was to confirm that phytosterols were able to bind to chondrocytes; we used an original approach consisting of analysing by mass spectrometry, after obtaining chondrocyte homogenate following phytosterol incubation. Campesterol, sitosterol and stigmasterol are the main components of a great variety of plants and generally found together. Plat et al. found a preferential incorporation of campesterol in various tissues
      • Plat J.
      • de Jong A.
      • Volger O.L.
      • Princen H.M.
      • Mensink R.P.
      Preferential campesterol incorporation into various tissues in apolipoprotein E*3-Leiden mice consuming plant sterols or stanols.
      . But very little has been done to compare the potential effect of three sterols on a specific tissue. Furthermore, we looked at the presence of the phytosterols upon the cell membrane, assessed by mass spectrometry after lipid extraction and to obtain two parts of the cell membrane, the soluble fraction and the detergent resistant membrane or DRM. We also extracted the membrane lipids on a sucrose gradient as described by Bligh and Dyer
      • Bligh E.G.
      • Dyer W.J.
      A rapid method of total lipid extraction and purification.
      , to obtain different fractions, including the lipid rafts (fractions 4, 5, 6) Fraction 11 is constituted by the cytoskeleton and the part of the membrane still bound to it. Lipid rafts are dynamic microdomains of the membrane, rich in cholesterol and sphingolipids
      • Kusumi A.
      • Suzuki K.
      Toward understanding the dynamics of membrane-raft-based molecular interactions.
      .
      Indeed, we have found a great amount of stigmasterol in DRM and lipid rafts of the chondrocyte membranes. We have additionally confirmed the presence of Caveolin-1, a lipid raft marker, in the fractions containing stigmasterol, by western blot (data not shown). Lipid rafts are known to be the “signaling platform” of the cell
      • Kusumi A.
      • Suzuki K.
      Toward understanding the dynamics of membrane-raft-based molecular interactions.
      and many receptors are detected in these parts of the cell membranes, such as cytokine receptors, glucocorticoïds receptors or integrins. Lipid rafts act like a platform of recruitment for different proteins
      • Kusumi A.
      • Suzuki K.
      Toward understanding the dynamics of membrane-raft-based molecular interactions.
      . Sebald et al. have studied NF-κB and shown that all the members of the NF-κB family, included I-kappa B Kinase (IKK), are found constitutively and inductively in lipid rafts. NF-kappa B Inducing Kinase (NIK) seems to be the first kinase involved in the complex bound to the rafts
      • Sebald A.
      • Mattioli I.
      • Schmitz M.L.
      T cell receptor-induced lipid raft recruitment of the I kappa B kinase complex is necessary and sufficient for NF-kappa B activation occurring in the cytosol.
      . This could explain the mechanism by which stigmasterol acts and its potential involvement in signaling pathways, like the NF-κB pathway.
      Aggrecanase 1 and aggrecanase 2, known as ADAMTS-4 and ADAMTS-5, have been shown to be involved in aggrecan degradation in the extra-cellular matrix (ECM)
      • Tortorella M.D.
      • Malfait A.M.
      • Deccico C.
      • Arner E.
      The role of ADAM-TS4 (aggrecanase-1) and ADAM-TS5 (aggrecanase-2) in a model of cartilage degradation.
      . ADAMTS-4 is induced by IL-1β and fibronectin fragments
      • Tortorella M.D.
      • Malfait A.M.
      • Deccico C.
      • Arner E.
      The role of ADAM-TS4 (aggrecanase-1) and ADAM-TS5 (aggrecanase-2) in a model of cartilage degradation.
      . ADAMTS-5 is constitutively expressed in cartilage, and is found to be increased in OA patients
      • Plaas A.
      • Osborn B.
      • Yoshihara Y.
      • Bai Y.
      • Bloom T.
      • Nelson F.
      • et al.
      Aggrecanolysis in human osteoarthritis: confocal localization and biochemical characterization of ADAMTS5-hyaluronan complexes in articular cartilages.
      , confirming its key role in this pathology. ADAMTS-5 knock-out mice prevent cartilage degradation in an experimental model of OA
      • Glasson S.S.
      • Askew R.
      • Sheppard B.
      • Carito B.
      • Blanchet T.
      • Ma H.L.
      • et al.
      Deletion of active ADAMTS5 prevents cartilage degradation in a murine model of osteoarthritis.
      . It has been shown that aggrecan loss from mouse cartilage is predominantly because of ADAMTS-5 activity
      • Ilic M.Z.
      • East C.J.
      • Rogerson F.M.
      • Fosang A.J.
      • Handley C.J.
      Distinguishing aggrecan loss from aggrecan proteolysis in ADAMTS-4 and ADAMTS-5 single and double deficient mice.
      . That is the reason why it is commonly admitted that IL-1β regulates differently ADAMTS in human and mouse. ADAMTS-4 seems to be regulated by IL-1β in human
      • Fosang A.J.
      • Rogerson F.M.
      • East C.J.
      • Stanton H.
      ADAMTS-5: the story so far.
      . But Koshy et al. have shown that there is a synergistic induction of gene expression of both ADAMTS by IL-1β
      • Koshy P.J.
      • Lundy C.J.
      • Rowan A.D.
      • Porter S.
      • Edwards D.R.
      • Hogan A.
      • et al.
      The modulation of matrix metalloproteinase and ADAM gene expression in human chondrocytes by interleukin-1 and oncostatin M: a time-course study using real-time quantitative reverse transcription-polymerase chain reaction.
      • Koshy P.J.
      • Henderson N.
      • Logan C.
      • Life P.F.
      • Cawston T.E.
      • Rowan A.D.
      Interleukin 17 induces cartilage collagen breakdown: novel synergistic effects in combination with proinflammatory cytokines.
      . In our model, our results show that ADAMTS-4 is induced by IL-1β in human, whereas ADAMTS-5 is constitutively expressed in both species, and does not vary in presence of IL-1β. We could hypothesize that ADAMTS-5, which is constitutively expressed in cartilage, acts synergistically with ADAMTS-4 only when the OA process is enhanced. Moreover, we show that stigmasterol plays a role in reducing IL-1β-induced ADAMTS-4 gene expression in both species.
      We expected, in our model, to have a beneficial action of stigmasterol on loss of aggrecan and type II collagen, at a RNA level. After studying these two factors, we did not see any difference in mouse chondrocytes. However, we did not perform the same experiments in human chondrocytes. Maybe the incubation with stigmasterol should be longer to see any effect on a reduction of ADAMTS-4-IL-1β stimulated mRNA. It could be the same concerning Collagen 2 mRNA.
      IL-6 is a pro-inflammatory cytokine which plays a synergistic effect with IL-1β in several inflammatory processes
      • Flannery C.R.
      • Little C.B.
      • Hughes C.E.
      • Curtis C.L.
      • Caterson B.
      • Jones S.A.
      IL-6 and its soluble receptor augment aggrecanase-mediated proteoglycan catabolism in articular cartilage.
      . Our results show an 256-fold increase of IL-6 production after IL-1β stimulation in mouse and an 20-fold increase in human chondrocytes. However, no variation of IL-6 expression was observed after a pre-incubation with stigmasterol (data not shown) This lack of efficiency with stigmasterol is surprising, because IL-6 seems to act together with IL-1β and should be affected by stigmasterol as IL-1 is. However, so far some publication have been shown that IL-6 cross talk with transforming growth factor (TGF)-β
      • Liton P.B.
      • Li G.
      • Luna C.
      • Gonzalez P.
      • Epstein D.L.
      Cross-talk between TGF-beta1 and IL-6 in human trabecular meshwork cells.
      and have been shown to be an important inhibitor of cell death
      • Jin X.
      • Zimmers T.A.
      • Zhang Z.
      • Peirce R.H.
      • Koniaris L.G.
      Interleukin-6 is an important in vivo inhibitor of intestinal epithelial cell death in mice.
      . In our model, IL-6 could play as well a different role as an inflammatory cytokine, as IL-1β, that could be the reason why it is not affected by stigmasterol.
      The question remains: could stigmasterol penetrate cartilage? We previously described, in another publication, that cartilage explants incubated during 48 h with a compound rich in phytosterols, shows salient effects on inflammatory mediators and pro-degrading enzymes, as well as on signaling pathways involved in inflammation
      • Gabay O.
      • Gosset M.
      • Levy A.
      • Salvat C.
      • Sanchez C.
      • Pigenet A.
      • et al.
      Stress-induced signaling pathways in hyalin chondrocytes: inhibition by Avocado-Soybean Unsaponifiables (ASU).
      The compound seems to penetrate into the cartilage (at last into the superficial zone) after 48 h incubation. Cartilage explants incubation with stigmasterol in the same conditions could result in similar effects. In this work, we saw that phytosterols (stigmasterol, campesterol, sitosterol) are able to bind chondrocytes membranes and are found in great amount in chondrocytes homogenates after 48 h stigmasterol incubation.
      In conclusion, our work shows that stigmasterol is a plant sterol able to bind to chondrocyte membrane and possesses potential anti-inflammatory and anti-catabolic properties. Stigmasterol counteracts the expression of the MMPs involved in cartilage degradation along with an inhibitory effect on the pro-inflammatory mediator PGE2, at least in part via the inhibition of the NF-kappa B pathway. Thus, stigmasterol, by preventing the expression of deleterious mediators should be considered as a target if future in vivo experiments confirm these in-vitro data. However, more in-vitro experiments are needed to complete these preliminary results.

      Conflict of interest

      The authors have no conflict of interest.

      Acknowledgements

      We thank Prof. Yves Henrotin, Doctors Marjolaine Gosset and Regis Blaise for their assistance, Audrey Pigenet for her technical assistance, Dr Mona Dvir-Ginzberg for reviewing the manuscript and Dr Benjamin Lelouvier for his help in statistical analysis.
      Christelle Sanchez is a post-doctoral researcher of Belgian Fond National de la Recherche Scientifique (FNRS).

      References

        • Loeser R.F.
        Aging and osteoarthritis: the role of chondrocyte senescence and aging changes in the cartilage matrix.
        Osteoarthritis Cartilage. 2009; 17: 971-979
        • Goldring M.B.
        • Otero M.
        • Tsuchimochi K.
        • Ijiri K.
        • Li Y.
        Defining the roles of inflammatory and anabolic cytokines in cartilage metabolism.
        Ann Rheum Dis. 2008 Dec; 67: iii75-iii82
        • Krasnokutsky S.
        • Attur M.
        • Palmer G.
        • Samuels J.
        • Abramson S.B.
        Current concepts in the pathogenesis of osteoarthritis.
        Osteoarthritis Cartilage. 2008; 16: S1-S3
        • Attur M.
        • Al-Mussawir H.E.
        • Patel J.
        • Kitay A.
        • Dave M.
        • Palmer G.
        • et al.
        Prostaglandin E2 exerts catabolic effects in osteoarthritis cartilage: evidence for signaling via the EP4 receptor.
        J Immunol. 2008 Oct 1; 181: 5082-5088
        • Akaogi J.
        • Nozaki T.
        • Satoh M.
        • Yamada H.
        Role of PGE2 and EP receptors in the pathogenesis of rheumatoid arthritis and as a novel therapeutic strategy.
        Endocr Metab Immune Disord Drug Targets. 2006 Dec; 6: 383-394
        • Plaas A.
        • Osborn B.
        • Yoshihara Y.
        • Bai Y.
        • Bloom T.
        • Nelson F.
        • et al.
        Aggrecanolysis in human osteoarthritis: confocal localization and biochemical characterization of ADAMTS5-hyaluronan complexes in articular cartilages.
        Osteoarthritis Cartilage. 2007 Jul; 15: 719-734
        • Khanna D.
        • Sethi G.
        • Ahn K.S.
        • Pandey M.K.
        • Kunnumakkara A.B.
        • Sung B.
        • et al.
        Natural products as a gold mine for arthritis treatment.
        Curr Opin Pharmacol. 2007 Jun; 7: 344-351
        • Aggarwal B.B.
        • Takada Y.
        • Shishodia S.
        • Gutierrez A.M.
        • Oommen O.V.
        • Ichikawa H.
        • et al.
        Nuclear transcription factor NF-kappa B: role in biology and medicine.
        Indian J Exp Biol. 2004 Apr; 42: 341-353
        • Aggarwal B.B.
        Nuclear factor-kappaB: the enemy within.
        Cancer Cell. 2004 Sep; 6: 203-208
        • Kasinski A.L.
        • Du Y.
        • Thomas S.L.
        • Zhao J.
        • Sun S.Y.
        • Khuri F.R.
        • et al.
        Inhibition of IkappaB kinase-nuclear factor-kappaB signaling pathway by 3,5-bis(2-flurobenzylidene)piperidin-4-one (EF24), a novel monoketone analog of curcumin.
        Mol Pharmacol. 2008 Sep; 74: 654-661
        • Aggarwal B.B.
        • Shishodia S.
        Suppression of the nuclear factor-kappaB activation pathway by spice-derived phytochemicals: reasoning for seasoning.
        Ann N Y Acad Sci. 2004 Dec; 1030: 434-441
        • Ahmed S.
        • Wang N.
        • Lalonde M.
        • Goldberg V.M.
        • Haqqi T.M.
        Green tea polyphenol epigallocatechin-3-gallate (EGCG) differentially inhibits interleukin-1 beta-induced expression of matrix metalloproteinase-1 and -13 in human chondrocytes.
        J Pharmacol Exp Ther. 2004 Feb; 308: 767-773
        • Cheon J.H.
        • Kim J.S.
        • Kim J.M.
        • Kim N.
        • Jung H.C.
        • Song I.S.
        Plant sterol guggulsterone inhibits nuclear factor-kappaB signaling in intestinal epithelial cells by blocking IkappaB kinase and ameliorates acute murine colitis.
        Inflamm Bowel Dis. 2006 Dec; 12: 1152-1161
        • Shishodia S.
        • Aggarwal B.B.
        Guggulsterone inhibits NF-kappaB and IkappaBalpha kinase activation, suppresses expression of anti-apoptotic gene products, and enhances apoptosis.
        J Biol Chem. 2004 Nov 5; 279: 47148-47158
        • Moussaieff A.
        • Shohami E.
        • Kashman Y.
        • Fride E.
        • Schmitz M.L.
        • Renner F.
        • et al.
        Incensole acetate, a novel anti-inflammatory compound isolated from Boswellia resin, inhibits nuclear factor-kappa B activation.
        Mol Pharmacol. 2007 Dec; 72: 1657-1664
        • Ichikawa H.
        • Takada Y.
        • Shishodia S.
        • Jayaprakasam B.
        • Nair M.G.
        • Aggarwal B.B.
        Withanolides potentiate apoptosis, inhibit invasion, and abolish osteoclastogenesis through suppression of nuclear factor-kappaB (NF-kappaB) activation and NF-kappaB-regulated gene expression.
        Mol Cancer Ther. 2006 Jun; 5: 1434-1445
        • Thiers H.
        Rev Rhum Mal Osteoartic. 1953 Aug–Sep; 20: 636-643
        • Navarro A.
        • De las Heras B.
        • Villar A.
        Anti-inflammatory and immunomodulating properties of a sterol fraction from Sideritis foetens Clem.
        Biol Pharm Bull. 2001 May; 24: 470-473
        • Bouic P.J.
        • Clark A.
        • Lamprecht J.
        • Freestone M.
        • Pool E.J.
        • Liebenberg R.W.
        • et al.
        The effects of B-sitosterol (BSS) and B-sitosterol glucoside (BSSG) mixture on selected immune parameters of marathon runners: inhibition of post marathon immune suppression and inflammation.
        Int J Sports Med. 1999 May; 20: 258-262
        • Bouic P.J.
        • Lamprecht J.H.
        Plant sterols and sterolins: a review of their immune-modulating properties.
        Altern Med Rev. 1999 Jun; 4: 170-177
        • Lefebvre V.
        • Garofalo S.
        • Zhou G.
        • Metsaranta M.
        • Vuorio E.
        • De Crombrugghe B.
        Characterization of primary cultures of chondrocytes from type II collagen/beta-galactosidase transgenic mice.
        Matrix Biol. 1994 Aug; 14: 329-335
        • Salvat C.P.A.
        • Humbert L.
        • Berenbaum F.
        • Thirion S.
        Immature murine articular chondrocytes in primary culture: a new tool for investigating cartilage.
        Osteoarthritis Cartilage. 2005Mar; 13: 243-249
        • Sanchez C.
        • Mathy-Hartert M.
        • Deberg M.A.
        • Ficheux H.
        • Reginster J.Y.
        • Henrotin Y.E.
        Effects of rhein on human articular chondrocytes in alginate beads.
        Biochem Pharmacol. 2003 Feb 1; 65: 377-388
        • Bligh E.G.
        • Dyer W.J.
        A rapid method of total lipid extraction and purification.
        Can J Biochem Physiol. 1959 Aug; 37: 911-917
        • Van Horn L.
        Diet and heart disease: continuing contributions.
        J Am Diet Assoc. 2008 Feb; 108 (Editor's outlook): 203
        • Wlodarek D.
        Rocz Panstw Zakl Hig. 2007; 58: 47-51
        • Naruszewicz M.
        • Kozlowska-Wojciechowska M.
        Plant sterols beyond low-density lipoprotein-cholesterol.
        Br J Nutr. 2007 Sep; 98: 454-455
        • Patch C.S.
        • Tapsell L.C.
        • Williams P.G.
        • Gordon M.
        Plant sterols as dietary adjuvants in the reduction of cardiovascular risk: theory and evidence.
        Vasc Health Risk Manag. 2006; 2: 157-162
        • Calpe-Berdiel L.
        • Escola-Gil J.C.
        • Rotllan N.
        • Blanco-Vaca F.
        Phytosterols do not change susceptibility to obesity, insulin resistance, and diabetes induced by a high-fat diet in mice.
        Metabolism. 2008 Nov; 57: 1497-1501
        • Gabay O.
        • Gosset M.
        • Levy A.
        • Salvat C.
        • Sanchez C.
        • Pigenet A.
        • et al.
        Stress-induced signaling pathways in hyalin chondrocytes: inhibition by Avocado-Soybean Unsaponifiables (ASU).
        Osteoarthritis Cartilage. 2008; 16: 373-384
        • Plat J.
        • de Jong A.
        • Volger O.L.
        • Princen H.M.
        • Mensink R.P.
        Preferential campesterol incorporation into various tissues in apolipoprotein E*3-Leiden mice consuming plant sterols or stanols.
        Metabolism. 2008 Sep; 57: 1241-1247
        • Kusumi A.
        • Suzuki K.
        Toward understanding the dynamics of membrane-raft-based molecular interactions.
        Biochim Biophys Acta. 2005 Dec 30; 1746: 234-251
        • Sebald A.
        • Mattioli I.
        • Schmitz M.L.
        T cell receptor-induced lipid raft recruitment of the I kappa B kinase complex is necessary and sufficient for NF-kappa B activation occurring in the cytosol.
        Eur J Immunol. 2005 Jan; 35: 318-325
        • Tortorella M.D.
        • Malfait A.M.
        • Deccico C.
        • Arner E.
        The role of ADAM-TS4 (aggrecanase-1) and ADAM-TS5 (aggrecanase-2) in a model of cartilage degradation.
        Osteoarthritis Cartilage. 2001 Aug; 9: 539-552
        • Glasson S.S.
        • Askew R.
        • Sheppard B.
        • Carito B.
        • Blanchet T.
        • Ma H.L.
        • et al.
        Deletion of active ADAMTS5 prevents cartilage degradation in a murine model of osteoarthritis.
        Nature. 2005 Mar 31; 434: 644-648
        • Ilic M.Z.
        • East C.J.
        • Rogerson F.M.
        • Fosang A.J.
        • Handley C.J.
        Distinguishing aggrecan loss from aggrecan proteolysis in ADAMTS-4 and ADAMTS-5 single and double deficient mice.
        J Biol Chem. 2007 Dec 28; 282: 37420-37428
        • Fosang A.J.
        • Rogerson F.M.
        • East C.J.
        • Stanton H.
        ADAMTS-5: the story so far.
        Eur Cell Mater. 2008; 15: 11-26
        • Koshy P.J.
        • Lundy C.J.
        • Rowan A.D.
        • Porter S.
        • Edwards D.R.
        • Hogan A.
        • et al.
        The modulation of matrix metalloproteinase and ADAM gene expression in human chondrocytes by interleukin-1 and oncostatin M: a time-course study using real-time quantitative reverse transcription-polymerase chain reaction.
        Arthritis Rheum. 2002 Apr; 46: 961-967
        • Koshy P.J.
        • Henderson N.
        • Logan C.
        • Life P.F.
        • Cawston T.E.
        • Rowan A.D.
        Interleukin 17 induces cartilage collagen breakdown: novel synergistic effects in combination with proinflammatory cytokines.
        Ann Rheum Dis. 2002 Aug; 61: 704-713
        • Flannery C.R.
        • Little C.B.
        • Hughes C.E.
        • Curtis C.L.
        • Caterson B.
        • Jones S.A.
        IL-6 and its soluble receptor augment aggrecanase-mediated proteoglycan catabolism in articular cartilage.
        Matrix Biol. 2000 Nov; 19: 549-553
        • Liton P.B.
        • Li G.
        • Luna C.
        • Gonzalez P.
        • Epstein D.L.
        Cross-talk between TGF-beta1 and IL-6 in human trabecular meshwork cells.
        Mol Vis. 2009; 15: 326-334
        • Jin X.
        • Zimmers T.A.
        • Zhang Z.
        • Peirce R.H.
        • Koniaris L.G.
        Interleukin-6 is an important in vivo inhibitor of intestinal epithelial cell death in mice.
        Gut. 2009 Feb 3;